Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name COX6A1P5
Wait
Plot displaying the genomic locations of a retrocopy (in chr7) and its respective parental gene (in chr12). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr7:123932225-123932468  UCSC
Coordinates (T2T) chr7:125248940-125249183  UCSC
Coordinates (hg19) chr7:123572279-123572522  UCSC
Strand +
Parental Sequence NM_004373.4
Parental seq. overlap 195 bp
Parental seq. overlap (%) 36.3%
Genomic Region Intragenic (SPAM1)
Retrocopy Summary COX6A1P5, located on chr7:123932225-123932468, is a retrocopy of the parental gene COX6A1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX6A1
Full Name cytochrome c oxidase subunit 6A1
Also known as CMTRID|COX6A|COX6AL
Coordinate chr12:120438113-120440730
Strand +
Gene summary Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in the electron transfer and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (liver isoform) of subunit VIa, and polypeptide 1 is found in all non-muscle tissues. Polypeptide 2 (heart/muscle isoform) of subunit VIa is encoded by a different gene, and is present only in striated muscles. These two polypeptides share 66% amino acid sequence identity. It has been reported that there may be several pseudogenes on chromosomes 1, 6, 7q21, 7q31-32 and 12. However, only one pseudogene (COX6A1P) on chromosome 1p31.1 has been documented. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX6A1P5
Bonobo Pan paniscus LOC103783978P5
Gorilla Gorilla gorilla LOC101131776P4
Orangutan Pongo abelii LOC103892145P3
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

Related Sequence

>COX6A1P5
GGAGGGCTCAGCTAGTATGTGGAAGACCCTCACCTATTTTGTTGTGCTTCCTCGGGTGGGAGTGAGCATGATAATTGTTTTCTTGAAGTTGCATCGTGGAGAGCACAGGAGACCTGAGTTGATTCCTTACCCCCATCTCTGCATTAGATCCAAATCTTTTCCTTGAGGAGATGGTAACCATACTGTATTTCATAACCTTCATGTGAATCTGTTTCTAACTGCCTATGAAGATGAATAAAGAGAA
>NM_004373.4
AGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCGCCCACAGCTGGGGCGGCCTATGTCGAGTGGCGCCCATGGCGAAGAGGGCTCAGCTCGCATGTGGAAGACTCTCACCTTCTTCGTCGCGCTCCCCGGGGTGGCAGTCAGCATGCTGAATGTGTACCTGAAGTCGCACCACGGAGAGCACGAGAGACCCGAGTTCATCGCCTACCCCCATCTCCGCATCAGGACCAAGCCGTTTCCCTGGGGAGATGGTAACCATACTCTATTCCATAACCCTCATGTGAATCCACTTCCAACTGGCTACGAAGATGAATAAAGAGAATCTGGACCACTACCCGGGCACCAGGGACCACAGCACTGGTTTGGACCGTTACTCTGCACATGGACCAGAAAAAGTATATGGGACCTTAAGCTCACCTTCTTTACTTGTATCAAATGATGACTGGTATACTGGTCTCCCATCCCTTTGCTTGTGGCAGGAGATGGCTTAAATAAATAACTTAAATTTA

Publications

PMID - Link Title
No publications available for this retrocopy