Retrocopy Name | COX6A1P6 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr11:80957460-80957828 UCSC | |
Coordinates (T2T) | chr11:80892227-80892595 UCSC | |
Coordinates (hg19) | chr11:80668503-80668871 UCSC | |
Strand | + | |
Parental Sequence | NM_004373.4 | |
Parental seq. overlap | 308 bp | |
Parental seq. overlap (%) | 56.4% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | COX6A1P6, located on chr11:80957460-80957828, is a retrocopy of the parental gene COX6A1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | COX6A1 |
Full Name | cytochrome c oxidase subunit 6A1 |
Also known as | CMTRID|COX6A|COX6AL |
Coordinate | chr12:120438113-120440730 |
Strand | + |
Gene summary | Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in the electron transfer and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (liver isoform) of subunit VIa, and polypeptide 1 is found in all non-muscle tissues. Polypeptide 2 (heart/muscle isoform) of subunit VIa is encoded by a different gene, and is present only in striated muscles. These two polypeptides share 66% amino acid sequence identity. It has been reported that there may be several pseudogenes on chromosomes 1, 6, 7q21, 7q31-32 and 12. However, only one pseudogene (COX6A1P) on chromosome 1p31.1 has been documented. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | COX6A1P6 |
![]() |
Bonobo | Pan paniscus | LOC103783978P6 |
![]() |
Gorilla | Gorilla gorilla | LOC101131776P5 |
![]() |
Gibbon | Nomascus leucogenys | LOC100582575P3 |
![]() |
Green monkey | Chlorocebus sabaeus | LOC103239250P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | LOC102141433P4 |
![]() |
Rhesus | Macaca mulatta | LOC696956P4 |
![]() |
Baboon | Papio anubis | LOC103876119P5 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104666251P5 |
![]() |
Marmoset | Callithrix jacchus | LOC100388954P8 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>COX6A1P6 |
TTGCTAAATGTGTTCCTGAAGTCGCACCACAGAGAGCATGAGAGGCCTGAGTTCATTGAGTTCATTGCCTACTCCCATCTCCCGATCAAGTTCAAGTCCTTTCCCTGCAGAGATGGTAACCACACTTTATTCCATAACCTTCATGTGAATCGGCCTCCAACTAGCTATGAAAGTGAATAAAGAGAATCTGGGCCACTACCCTGACACTGGGGACCAAAGCAATGGTTTGGACCATTACTCTGCACACAGACCAGAAAAAGTACAGGGAACCTTAAGCTCACCTTCTTCACTTGTATCAAATGATGACTACTATGCTGATCTTCCATCTCTTAGCTTTTGGTGGGAGATGGCTTAAATAAATAACTTAAA |
>NM_004373.4 |
AGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCGCCCACAGCTGGGGCGGCCTATGTCGAGTGGCGCCCATGGCGAAGAGGGCTCAGCTCGCATGTGGAAGACTCTCACCTTCTTCGTCGCGCTCCCCGGGGTGGCAGTCAGCATGCTGAATGTGTACCTGAAGTCGCACCACGGAGAGCACGAGAGACCCGAGTTCATCGCCTACCCCCATCTCCGCATCAGGACCAAGCCGTTTCCCTGGGGAGATGGTAACCATACTCTATTCCATAACCCTCATGTGAATCCACTTCCAACTGGCTACGAAGATGAATAAAGAGAATCTGGACCACTACCCGGGCACCAGGGACCACAGCACTGGTTTGGACCGTTACTCTGCACATGGACCAGAAAAAGTATATGGGACCTTAAGCTCACCTTCTTTACTTGTATCAAATGATGACTGGTATACTGGTCTCCCATCCCTTTGCTTGTGGCAGGAGATGGCTTAAATAAATAACTTAAATTTA |
PMID - Link | Title |
---|