Summary

Gene Name	COX6B1
Specie	Homo sapiens
Full Name	cytochrome c oxidase subunit 6B1
Also known as	COX6B|COXG|COXVIb1|MC4DN7
Coordinate	chr19:35648323-35658782
Strand	+
Gene summary	Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIb. Mutations in this gene are associated with severe infantile encephalomyopathy. Three pseudogenes COX6BP-1, COX6BP-2 and COX6BP-3 have been found on chromosomes 7, 17 and 22q13.1-13.2, respectively. [provided by RefSeq, Jan 2010]

Retrocopy(s) from COX6B1

Retroname	Coord	Strand	Genomic Region	ENSG
COX6B1P7	chr1:68282313-68282754	+	Intergenic	ENSG00000225242	UCSC
COX6B1P2	chr17:48713723-48714023	+	Intergenic	ENSG00000241788	UCSC
COX6B1P3	chr22:40569282-40569433	+	Intragenic	ENSG00000172912	UCSC
COX6B1P5	chr4:2234244-2234460	+	Intragenic Intragenic	ENSG00000249047	UCSC
COX6B1P1	chr7:149053893-149054307	+	Intergenic	ENSG00000234565	UCSC
COX6B1P4	chr8:26835933-26836250	-	Intragenic Intragenic	ENSG00000253813	UCSC

Expression

Transcript Sequences

>NM_001863.5

AGTAGTTCCGCTTCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAGCACCATGGCGGAAGACATGGAGACCAAAATCAAGAACTACAAGACCGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACTAGAAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGTCAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACCAGCGTGTGTACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGATGAGCAACGGGCTGAAGGCACGTTTCCCGGGAAGATCTGAACTGGCTGCATCTCCCTTTCCTCTGTCCTCCATCCTTCTCCCAGGATGGTGAAGGGGGACCTGGTACCCAGTGATCCCCACCCCAGGATCCTAAATCATGACTTACCTGCTAATAAAAACTCATTGGAAAAGTGA