Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name COX6B1P4
Wait
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr8:26835933-26836250  UCSC
Coordinates (T2T) chr8:27112757-27113074  UCSC
Coordinates (hg19) chr8:26693450-26693767  UCSC
Strand -
Parental Sequence NM_001863.5
Parental seq. overlap 274 bp
Parental seq. overlap (%) 55.7%
Genomic Region Intragenic (ADRA1D)
Intragenic (ADRA1A)
Retrocopy Summary COX6B1P4, located on chr8:26835933-26836250, is a retrocopy of the parental gene COX6B1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX6B1
Full Name cytochrome c oxidase subunit 6B1
Also known as COX6B|COXG|COXVIb1|MC4DN7
Coordinate chr19:35648323-35658782
Strand +
Gene summary Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIb. Mutations in this gene are associated with severe infantile encephalomyopathy. Three pseudogenes COX6BP-1, COX6BP-2 and COX6BP-3 have been found on chromosomes 7, 17 and 22q13.1-13.2, respectively. [provided by RefSeq, Jan 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX6B1P4
Bonobo Pan paniscus LOC100972703P4
Gorilla Gorilla gorilla LOC101139203P5
Orangutan Pongo abelii COX6B1P4
Gibbon Nomascus leucogenys LOC100606627P2
Crab-eating macaque Macaca fascicularis LOC102143756P5
Rhesus Macaca mulatta COX6B1P5
Baboon Papio anubis LOC101010708P5
Golden snub-nosed monkey Rhinopithecus roxellana LOC104667089P4
Green monkey Chlorocebus sabaeus Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.51
log10(TPM+1)

Related Sequence

>COX6B1P4
CTTTAGAAGTCAGCACCTTGGCAAAAGACATGAAGACCAAAATCAAGAACTACAAGACTGCCCCTTTTGACAGACGCTTCCCCAACCAGACTAGGAACTGCTGGCAGAACTTCCTGGACTTCCACCTCTGTGAGAAGGCAACAACCGCTGAAGGGTGTGATGTCTCTATGTGTGAATGATACCAGTGTGTGTACAAGTTCTTCTGCCCTGCTCCTGGGTTTCAGTCTAGGATGACAGCTGGGCTAAAGGCACATTTCCTGGAAAGATCTGAACTGGCTGCATCTTACCCCTCCTATGTCCTTCATCCTTCTCCCAGGC
>NM_001863.5
AGTAGTTCCGCTTCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAGCACCATGGCGGAAGACATGGAGACCAAAATCAAGAACTACAAGACCGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACTAGAAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGTCAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACCAGCGTGTGTACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGATGAGCAACGGGCTGAAGGCACGTTTCCCGGGAAGATCTGAACTGGCTGCATCTCCCTTTCCTCTGTCCTCCATCCTTCTCCCAGGATGGTGAAGGGGGACCTGGTACCCAGTGATCCCCACCCCAGGATCCTAAATCATGACTTACCTGCTAATAAAAACTCATTGGAAAAGTGA

Publications

PMID - Link Title
No publications available for this retrocopy