Retrocopy Name | COX6B1P7 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr1:68282313-68282754 UCSC | |
Coordinates (T2T) | chr1:68159722-68160163 UCSC | |
Coordinates (hg19) | chr1:68747996-68748437 UCSC | |
Strand | + | |
Parental Sequence | NM_001863.5 | |
Parental seq. overlap | 359 bp | |
Parental seq. overlap (%) | 73.1% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | COX6B1P7, located on chr1:68282313-68282754, is a retrocopy of the parental gene COX6B1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | COX6B1 |
Full Name | cytochrome c oxidase subunit 6B1 |
Also known as | COX6B|COXG|COXVIb1|MC4DN7 |
Coordinate | chr19:35648323-35658782 |
Strand | + |
Gene summary | Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIb. Mutations in this gene are associated with severe infantile encephalomyopathy. Three pseudogenes COX6BP-1, COX6BP-2 and COX6BP-3 have been found on chromosomes 7, 17 and 22q13.1-13.2, respectively. [provided by RefSeq, Jan 2010] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | COX6B1P1 |
![]() |
Bonobo | Pan paniscus | LOC100972703P1 |
![]() |
Gorilla | Gorilla gorilla | LOC101139203P1 |
![]() |
Orangutan | Pongo abelii | COX6B1P1 |
![]() |
Gibbon | Nomascus leucogenys | LOC100606627P3 |
![]() |
Crab-eating macaque | Macaca fascicularis | LOC102143756P1 |
![]() |
Rhesus | Macaca mulatta | COX6B1P1 |
![]() |
Baboon | Papio anubis | LOC101010708P1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104667089P6 |
![]() |
Mouse lemur | Microcebus murinus | LOC105876919P1 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>COX6B1P7 |
GGAGGGTCACATGGAACTGCGAGTTGTGTCAGGGGAGTCTTTAGGAGTTAACACCATGGCGGAAGACACGGAGGCCAAATCAAGAACTACAGGACTGCCCCTTGTGGCAGCAACTTCCCCAGCCAGAACTAGACCAGAAACTACTGGTAGACCTACCTGGAATTCCACTGCTGCCAGAAGGCAATGACTGCTAAAGGGGGTTATGTCTTTGTGTGTGAATGGTACATGTGGACAAGACTCTCTGCCCTATATTATGGGTCTTAGCCTGGGACAAGTACCAGGCAGAAGGCATGTTTCCTGGGAAGATCTGAGCTTGCTCCACCCCACCTCTCTTCTGTCCTTTGTTCTTCTCCCAGGATGGTAAAGAGGGACCTGGGTACATAGTGATCCCTATCCTGGGACCCTGAATCATGACTTAACTAGCAATAACAACTCATTGGAA |
>NM_001863.5 |
AGTAGTTCCGCTTCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAGCACCATGGCGGAAGACATGGAGACCAAAATCAAGAACTACAAGACCGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACTAGAAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGTCAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACCAGCGTGTGTACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGATGAGCAACGGGCTGAAGGCACGTTTCCCGGGAAGATCTGAACTGGCTGCATCTCCCTTTCCTCTGTCCTCCATCCTTCTCCCAGGATGGTGAAGGGGGACCTGGTACCCAGTGATCCCCACCCCAGGATCCTAAATCATGACTTACCTGCTAATAAAAACTCATTGGAAAAGTGA |
PMID - Link | Title |
---|