Summary

Gene Name	COX7C
Specie	Homo sapiens
Full Name	cytochrome c oxidase subunit 7C
Also known as	-
Coordinate	chr5:86617941-86620962
Strand	+
Gene summary	Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIc, which shares 87% and 85% amino acid sequence identity with mouse and bovine COX VIIc, respectively, and is found in all tissues. A pseudogene COX7CP1 has been found on chromosome 13. [provided by RefSeq, Jul 2008]

Retrocopy(s) from COX7C

Retroname	Coord	Strand	Genomic Region	ENSG
COX7CP3	chr10:72560339-72560514	+	Intragenic	ENSG00000230609	UCSC
COX7CP4	chr11:118821918-118822218	+	Intergenic	ENSG00000254478	UCSC
COX7CP2	chr1:202767102-202767532	-	Intragenic	ENSG00000235449	UCSC
COX7CP1	chr13:49187358-49187749	-	Intragenic	ENSG00000235957	UCSC
COX7CP5	chr16:4433156-4433311	-	Intragenic	ENSG00000275515	UCSC

Expression

Transcript Sequences

>NM_001867.3

CTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCTTTCGCAGAGCTTCCAGCAGCGGTATGTTGGGCCAGAGCATCCGGAGGTTCACAACCTCTGTGGTCCGTAGGAGCCACTATGAGGAGGGCCCTGGGAAGAATTTGCCATTTTCAGTGGAAAACAAGTGGTCGTTACTAGCTAAGATGTGTTTGTACTTTGGATCTGCATTTGCTACACCCTTCCTTGTAGTAAGACACCAACTGCTTAAAACATAAGGATGTTTCAGTTCCTCCATTTAACAGATATGAAGAGCATTTTAAGAGGTGCAGCCTCTGGAAGTGGATCAAACTAGAACTCATATGCCATACTAGATATGTTTGTCAATAAACTTATGACGTGAATGCTTAATGCCTCTTTTTTGAAATAGGGAATGTAATAATTGGCCATTTGCCTACTTTATTATTTGGGTAACATTCCAGTATTACTCTCTGTGATTTAGCTTATTTAATGGTGTTAAACTGAGGTTATATTAAATTTTTGATTCCCAGGTCAGGATTTTGTTGGTAATTTATATAATAAAAGGGAAATACAAATCGA