| Retrocopy Name | COX7CP3 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr10:72560339-72560514 UCSC | |
| Coordinates (T2T) | chr10:73431664-73431839 UCSC | |
| Coordinates (hg19) | chr10:74320097-74320272 UCSC | |
| Strand | + | |
| Parental Sequence | NM_001867.3 | |
| Parental seq. overlap | 147 bp | |
| Parental seq. overlap (%) | 23.4% | |
| Genomic Region |
Intragenic (MICU1) |
|
| Retrocopy Summary | COX7CP3, located on chr10:72560339-72560514, is a retrocopy of the parental gene COX7C. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | COX7C |
| Full Name | cytochrome c oxidase subunit 7C |
| Also known as | - |
| Coordinate | chr5:86617941-86620962 |
| Strand | + |
| Gene summary | Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIc, which shares 87% and 85% amino acid sequence identity with mouse and bovine COX VIIc, respectively, and is found in all tissues. A pseudogene COX7CP1 has been found on chromosome 13. [provided by RefSeq, Jul 2008] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | COX7CP4 |
![]() |
Bonobo | Pan paniscus | LOC100979972P3 |
![]() |
Gorilla | Gorilla gorilla | LOC101133649P4 |
![]() |
Orangutan | Pongo abelii | COX7CP3 |
![]() |
Gibbon | Nomascus leucogenys | LOC100579903P4 |
![]() |
Rhesus | Macaca mulatta | LOC106998836P2 |
![]() |
Baboon | Papio anubis | LOC101014053P4 |
![]() |
Marmoset | Callithrix jacchus | LOC100415550P7 |
![]() |
Mouse lemur | Microcebus murinus | LOC109731319P4 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >COX7CP3 |
| AGGGAAGAACATGCTATTTTCAGTAGAAAATAAGTGGTGGTTACTAATTATAATGACTTTGCACTTTGGATCTGGATTTTATGCACATTTCTTTATAGTAAGACACCAACTGCTTAAGAAACAAGGATGTTTAATTCATCCATGAAACAGATATGAAGAGCATTTTAAGAGGTGCA |
| >NM_001867.3 |
| CTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCTTTCGCAGAGCTTCCAGCAGCGGTATGTTGGGCCAGAGCATCCGGAGGTTCACAACCTCTGTGGTCCGTAGGAGCCACTATGAGGAGGGCCCTGGGAAGAATTTGCCATTTTCAGTGGAAAACAAGTGGTCGTTACTAGCTAAGATGTGTTTGTACTTTGGATCTGCATTTGCTACACCCTTCCTTGTAGTAAGACACCAACTGCTTAAAACATAAGGATGTTTCAGTTCCTCCATTTAACAGATATGAAGAGCATTTTAAGAGGTGCAGCCTCTGGAAGTGGATCAAACTAGAACTCATATGCCATACTAGATATGTTTGTCAATAAACTTATGACGTGAATGCTTAATGCCTCTTTTTTGAAATAGGGAATGTAATAATTGGCCATTTGCCTACTTTATTATTTGGGTAACATTCCAGTATTACTCTCTGTGATTTAGCTTATTTAATGGTGTTAAACTGAGGTTATATTAAATTTTTGATTCCCAGGTCAGGATTTTGTTGGTAATTTATATAATAAAAGGGAAATACAAATCGA |
| PMID - Link | Title |
|---|