Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name COX7CP5
Plot displaying the genomic locations of a retrocopy (in chr16) and its respective parental gene (in chr5). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr16:4433156-4433311  UCSC
Coordinates (T2T) chr16:4462357-4462512  UCSC
Coordinates (hg19) chr16:4483157-4483312  UCSC
Strand -
Parental Sequence NM_001867.3
Parental seq. overlap 129 bp
Parental seq. overlap (%) 20.5%
Genomic Region Intragenic (DNAJA3)
Retrocopy Summary COX7CP5, located on chr16:4433156-4433311, is a retrocopy of the parental gene COX7C. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX7C
Full Name cytochrome c oxidase subunit 7C
Also known as -
Coordinate chr5:86617941-86620962
Strand +
Gene summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIc, which shares 87% and 85% amino acid sequence identity with mouse and bovine COX VIIc, respectively, and is found in all tissues. A pseudogene COX7CP1 has been found on chromosome 13. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX7CP7
Bonobo Pan paniscus LOC100979972P6
Gorilla Gorilla gorilla LOC101133649P7
Orangutan Pongo abelii COX7CP6
Rhesus Macaca mulatta LOC106998836P5
Baboon Papio anubis LOC101014053P7
Golden snub-nosed monkey Rhinopithecus roxellana LOC115896572P4
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>COX7CP5
ATTTGCCACTTTCAGTGGAAAACAAATGGCGGTTACTAACTAGGATGACTTTGTACTTTGGATCTGGATTCACAGCACCTTTTTTAATAGCAAGACACCAACTGCTTAAGAAACAAGGATGTTTTAGTTCATCCACTTAACAGATAGGAAGAGCAG
>NM_001867.3
CTTTTCAGTCCTTGCGCACCGGGGAACAAGGTCGTGAAAAAAAAGGTCTTGGTGAGGTGCCGCCATTTCATCTGTCCTCATTCTCTGCGCCTTTCGCAGAGCTTCCAGCAGCGGTATGTTGGGCCAGAGCATCCGGAGGTTCACAACCTCTGTGGTCCGTAGGAGCCACTATGAGGAGGGCCCTGGGAAGAATTTGCCATTTTCAGTGGAAAACAAGTGGTCGTTACTAGCTAAGATGTGTTTGTACTTTGGATCTGCATTTGCTACACCCTTCCTTGTAGTAAGACACCAACTGCTTAAAACATAAGGATGTTTCAGTTCCTCCATTTAACAGATATGAAGAGCATTTTAAGAGGTGCAGCCTCTGGAAGTGGATCAAACTAGAACTCATATGCCATACTAGATATGTTTGTCAATAAACTTATGACGTGAATGCTTAATGCCTCTTTTTTGAAATAGGGAATGTAATAATTGGCCATTTGCCTACTTTATTATTTGGGTAACATTCCAGTATTACTCTCTGTGATTTAGCTTATTTAATGGTGTTAAACTGAGGTTATATTAAATTTTTGATTCCCAGGTCAGGATTTTGTTGGTAATTTATATAATAAAAGGGAAATACAAATCGA

Publications

PMID - Link Title