| Gene Name | Gpx4 |
|
| Specie | Rattus norvegicus | |
| Full Name | glutathione peroxidase 4 | |
| Also known as | Gshpx-4|Phgpx|gpx-4|snGpx | |
| Coordinate | chr7:12516357-12519154 | |
| Strand | - | |
| Gene summary | The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Disruption of this gene in mouse spermatocytes is associated with male infertility. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. Pseudogenes of this locus have been identified on chromosomes 1, 10 and 14. [provided by RefSeq, Jan 2019] |
| Retroname | Coord | Strand | Genomic Region | ENSG | |
|---|---|---|---|---|---|
| Gpx4P1 | chr1:167286679-167287430 | - |
Intragenic |
N/A | UCSC |
| Gpx4P2 | chr1:61945157-61946044 | - |
Intergenic |
N/A | UCSC |
| Gpx4P3 | chr1:65056675-65057562 | - |
Intergenic |
N/A | UCSC |
| Gpx4P4 | chr10:63767998-63768688 | - |
Intragenic |
N/A | UCSC |
| Gpx4P5 | chr14:37904481-37905044 | + |
Intergenic |
N/A | UCSC |
| >NM_017165.2 |
| GACTCGGCCTCGCGCGTCCATTGGTCGGCTGCGTGAGGGGAGGAGCCGCTGGCTCCGGCCGCCGAGATGAGCTGGGGCCGTCTGAGCCGCTTATTGAAGCCAGCACTGCTGTGCGGGGCTCTGGCTGTGCCTGGCCTGGCTGGCACCATGTGTGCATCCCGCGATGATTGGCGCTGTGCGCGCTCCATGCACGAATTCGCAGCCAAGGACATCGATGGGCACATGGTTTGCCTGGATAAGTACAGGGGTTGCGTGTGCATCGTCACCAACGTGGCCTCGCAATGAGGCAAAACCGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATACGCCGAGTGTGGTTTACGAATCCTGGCCTTCCCTTGCAACCAGTTCGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCTACAATGTCAGGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCAGGTGATAGAGAAGGACCTGCCGTGCTATCTCTAGCCCTACAAGTGTGTGCCCCTGCACCGAGCCCCCCTGCCCTGTGACCCCTGGAGCCTTCCACCCCGGCACTCATGACGGTCTGCCTGAAAACCAGCCCGCTGGTGGGGCAGTCCCGAGGACCTGGCGTGCATCCCCGCCGGAGGAAGGTCCAGAGGCCTGTGGCCCCGGGCTCGAGCTTCACCTTGGCTGCCTTGTGGGAATAAAATGTAGAAATGTGC |