Retrocopy Name | Gpx4P5 |
|
Species | Rattus norvegicus | |
Coordinates | chr14:37904481-37905044 UCSC | |
Strand | + | |
Parental Sequence | NM_017165.2 | |
Parental seq. overlap | 513 bp | |
Parental seq. overlap (%) | 58.2% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | Gpx4P5, located on chr14:37904481-37905044, is a retrocopy of the parental gene Gpx4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | Gpx4 |
Full Name | glutathione peroxidase 4 |
Also known as | Gshpx-4|Phgpx|gpx-4|snGpx |
Coordinate | chr7:12516357-12519154 |
Strand | - |
Gene summary | The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Disruption of this gene in mouse spermatocytes is associated with male infertility. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. Pseudogenes of this locus have been identified on chromosomes 1, 10 and 14. [provided by RefSeq, Jan 2019] |
Species | Scientific Name | Retrocopy | |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>Gpx4P5 |
GGCCGAGATGAGCTGGGGCCGTCTGAGCTGCTTGATGAGCTCCTTGCTGTGCTGGGCTCTGGCTGCGCCTAGTCTGGAAGGCGCCATGTGTGCATCCCACGATGATTGGCGCTGTGCGCGCTACATGCATGAATTCTCAGTCAAGGACATCGACGGGTTTGCCTGGATAAGTACAGGGGTTTTTCTGCATCGTCACCAACGTACCTTGCAATGAGGCAAAACCAATGTAAACTACACTCAGCTAGTTGATCTGCGTGTCCGATATGTTGAGTGTGGTTTACGAATCCTGGCCTCCCCCTGCAACCAGTATACGAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCCACAATGTCAAGTTTAACATGTTCAGCAAGATCTGTGTGAATGGGGATGATGCCCACCCACTGTGAAAGTGGATGAAAGTTCAGCCCAAGGGCAGGGACATGCTGGGAAATGGCATCAAATGGAACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATCGAGGAGCCCCAGGTGATAGAGAAGGACCTGACGTGC |
>NM_017165.2 |
GACTCGGCCTCGCGCGTCCATTGGTCGGCTGCGTGAGGGGAGGAGCCGCTGGCTCCGGCCGCCGAGATGAGCTGGGGCCGTCTGAGCCGCTTATTGAAGCCAGCACTGCTGTGCGGGGCTCTGGCTGTGCCTGGCCTGGCTGGCACCATGTGTGCATCCCGCGATGATTGGCGCTGTGCGCGCTCCATGCACGAATTCGCAGCCAAGGACATCGATGGGCACATGGTTTGCCTGGATAAGTACAGGGGTTGCGTGTGCATCGTCACCAACGTGGCCTCGCAATGAGGCAAAACCGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATACGCCGAGTGTGGTTTACGAATCCTGGCCTTCCCTTGCAACCAGTTCGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCTACAATGTCAGGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCAGGTGATAGAGAAGGACCTGCCGTGCTATCTCTAGCCCTACAAGTGTGTGCCCCTGCACCGAGCCCCCCTGCCCTGTGACCCCTGGAGCCTTCCACCCCGGCACTCATGACGGTCTGCCTGAAAACCAGCCCGCTGGTGGGGCAGTCCCGAGGACCTGGCGTGCATCCCCGCCGGAGGAAGGTCCAGAGGCCTGTGGCCCCGGGCTCGAGCTTCACCTTGGCTGCCTTGTGGGAATAAAATGTAGAAATGTGC |
PMID - Link | Title |
---|