Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name Gpx4P4
Wait
Plot displaying the genomic locations of a retrocopy (in chr10) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Rattus norvegicus
Coordinates chr10:63767998-63768688  UCSC
Strand -
Parental Sequence NM_017165.2
Parental seq. overlap 608 bp
Parental seq. overlap (%) 68.5%
Genomic Region Intragenic (Pitpna)
Retrocopy Summary Gpx4P4, located on chr10:63767998-63768688, is a retrocopy of the parental gene Gpx4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Gpx4
Full Name glutathione peroxidase 4
Also known as Gshpx-4|Phgpx|gpx-4|snGpx
Coordinate chr7:12516357-12519154
Strand -
Gene summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Disruption of this gene in mouse spermatocytes is associated with male infertility. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. Pseudogenes of this locus have been identified on chromosomes 1, 10 and 14. [provided by RefSeq, Jan 2019]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Gpx4P4
TGAAGCCAGGACTGCTATGCGGGTTCTGGCTCACCTGGCCTGGCAGGCGCCACGTGTGCACCCCCCAGTGACTGGCGCTCTTCACGCTCCATGCATGAGTTCTCAGCCAAGGACATCGAAGCACATGGCTTGCCCGGATAAATAAAGGGGTTTCGTGTGCATCGTCACATCACCAACATGGCCTCACAATGAGGCAAAACTGATGTAAACTACACTCAGCTAGTCGATCTACATGCCTGATTTGCTGTGTGTAGCTTACGAATCTGGGCCTTGCCCTGCAACCAGTTCAGGAGGCAGGAGCCAAGAAGTAATTAAGAAATCAAGGAGTTTGCAGCCAGCTACAATGTCAAGTTTGACATGTACCGTCAAGATCTGTGTAAATGGGGATAATGCCTACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATACTGGGAAATGCCATCAAATGGAACTTTATCCCTACAAGTGTGTGCTACTGCACCAAGGCCCCCTGCCCTGTGACCCCTGGAGCTTTCCACCCTAGCACTCAGGATGGACTGCCTGAAAACCGGCCCACTGGTGGTGCAGTCCTGAGGACCTGGCATGCATCCCCACCAGAGGAAGGTCCACAGACGCCTGTGGCCCTGGGGCTCAAGTTTCACCTTGGCTGCCTTGTGGGAATAAAATGTAGAAATGTC
>NM_017165.2
GACTCGGCCTCGCGCGTCCATTGGTCGGCTGCGTGAGGGGAGGAGCCGCTGGCTCCGGCCGCCGAGATGAGCTGGGGCCGTCTGAGCCGCTTATTGAAGCCAGCACTGCTGTGCGGGGCTCTGGCTGTGCCTGGCCTGGCTGGCACCATGTGTGCATCCCGCGATGATTGGCGCTGTGCGCGCTCCATGCACGAATTCGCAGCCAAGGACATCGATGGGCACATGGTTTGCCTGGATAAGTACAGGGGTTGCGTGTGCATCGTCACCAACGTGGCCTCGCAATGAGGCAAAACCGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATACGCCGAGTGTGGTTTACGAATCCTGGCCTTCCCTTGCAACCAGTTCGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCTACAATGTCAGGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCAGGTGATAGAGAAGGACCTGCCGTGCTATCTCTAGCCCTACAAGTGTGTGCCCCTGCACCGAGCCCCCCTGCCCTGTGACCCCTGGAGCCTTCCACCCCGGCACTCATGACGGTCTGCCTGAAAACCAGCCCGCTGGTGGGGCAGTCCCGAGGACCTGGCGTGCATCCCCGCCGGAGGAAGGTCCAGAGGCCTGTGGCCCCGGGCTCGAGCTTCACCTTGGCTGCCTTGTGGGAATAAAATGTAGAAATGTGC

Publications

PMID - Link Title
No publications available for this retrocopy