Gene Name | RPL18A |
|
Specie | Homo sapiens | |
Full Name | ribosomal protein L18a | |
Also known as | L18A | |
Coordinate | chr19:17859910-17863319 | |
Strand | + | |
Gene summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18AE family of ribosomal proteins that is a component of the 60S subunit. The encoded protein may play a role in viral replication by interacting with the hepatitis C virus internal ribosome entry site (IRES). This gene is co-transcribed with the U68 snoRNA, located within the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012] |
Retroname | Coord | Strand | Genomic Region | ENSG | |
---|---|---|---|---|---|
RPL18AP3 | chr12:104265268-104265892 | + |
Intragenic |
ENSG00000213442 | UCSC |
RPL18AP18 | chr1:27176710-27177330 | + |
Intergenic |
ENSG00000229985 | UCSC |
RPL18AP19 | chr1:32979906-32980525 | + |
Intergenic |
ENSG00000217644 | UCSC |
RPL18AP24 | chr14:93223548-93224175 | - |
Intragenic |
ENSG00000240096 | UCSC |
RPL18AP25 | chr17:37162615-37163152 | + |
Intragenic |
ENSG00000276810 | UCSC |
RPL18AP26 | chr17:48881138-48881333 | + |
Intergenic |
ENSG00000248895 | UCSC |
RPL18AP27 | chr19:11521930-11522550 | + |
Intragenic |
ENSG00000213304 | UCSC |
RPL18AP20 | chr2:47690666-47691283 | - |
Intergenic |
ENSG00000230979 | UCSC |
RPL18AP7 | chr3:38526749-38527362 | - |
Intergenic |
ENSG00000232439 | UCSC |
RPL18AP21 | chr3:43484918-43485124 | - |
Intragenic |
ENSG00000223916 | UCSC |
RPL18AP8 | chr3:96619306-96619874 | + |
Intergenic |
ENSG00000218754 | UCSC |
RPL18AP22 | chr7:43274128-43274464 | + |
Intragenic |
ENSG00000213717 | UCSC |
RPL18AP23 | chr9:8713275-8713894 | + |
Intragenic |
ENSG00000212695 | UCSC |
RPL18AP14 | chrX:104803914-104804257 | + |
Intragenic |
ENSG00000223733 | UCSC |
RPL18AP15 | chrX:111624174-111624773 | - |
Intergenic |
ENSG00000236189 | UCSC |
RPL18AP16 | chrX:153662126-153662741 | + |
Intergenic |
ENSG00000237793 | UCSC |
>NM_000980.4 |
AGAGGACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGAGAGTACAAGGTAGTGGGTCGCTGCCTGCCCACCCCCAAATGCCACACGCCGCCCCTCTACCGCATGCGAATCTTTGCGCCTAATCATGTCGTCGCCAAGTCCCGCTTCTGGTACTTTGTATCTCAGTTAAAGAAGATGAAGAAGTCTTCAGGGGAGATTGTCTACTGTGGGCAGGTGTTTGAGAAGTCCCCCCTGCGGGTGAAGAACTTCGGGATCTGGCTGCGCTATGACTCCCGGAGCGGCACCCACAACATGTACCGGGAATACCGGGACCTGACCACCGCAGGCGCTGTCACCCAGTGCTACCGAGACATGGGTGCCCGGCACCGCGCCCGAGCCCACTCCATTCAGATCATGAAGGTGGAGGAGATCGCGGCCAGCAAGTGCCGCCGGCCGGCTGTCAAGCAGTTCCACGACTCCAAGATCAAGTTCCCGCTGCCCCACCGGGTCCTGCGCCGTCAGCACAAGCCACGCTTCACCACCAAGAGGCCCAACACCTTCTTCTAGGTGCAGGGCCCTCGTCCGGGTGTGCCCCAAATAAACTCAGGAACGCCCCGGTGCTC |