Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL18AP21
Plot displaying the genomic locations of a retrocopy (in chr3) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr3:43484918-43485124  UCSC
Coordinates (T2T) chr3:43500275-43500481  UCSC
Coordinates (hg19) chr3:43526410-43526616  UCSC
Strand -
Parental Sequence NM_000980.4
Parental seq. overlap 197 bp
Parental seq. overlap (%) 31.1%
Genomic Region Intragenic (ANO10)
Retrocopy Summary RPL18AP21, located on chr3:43484918-43485124, is a retrocopy of the parental gene RPL18A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL18A
Full Name ribosomal protein L18a
Also known as L18A
Coordinate chr19:17859910-17863319
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18AE family of ribosomal proteins that is a component of the 60S subunit. The encoded protein may play a role in viral replication by interacting with the hepatitis C virus internal ribosome entry site (IRES). This gene is co-transcribed with the U68 snoRNA, located within the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL18AP5
Bonobo Pan paniscus RPL18AP5
Gorilla Gorilla gorilla RPL18AP4
Orangutan Pongo abelii RPL18AP5
Green monkey Chlorocebus sabaeus RPL18AP8
Crab-eating macaque Macaca fascicularis LOC102140619P1
Rhesus Macaca mulatta LOC719242P2
Baboon Papio anubis RPL18AP5
Golden snub-nosed monkey Rhinopithecus roxellana RPL18AP3
Gibbon Nomascus leucogenys Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL18AP21
ATGAAGGTGGAGGTGATCGCAGCCAGCAAGTGCCGCCGGCCGGCTGTCAAGCAGTTCCACGACTCCAAGATCAAGTTCCTGCTGCCCCACCGGGTCCTGAGCCGTCAGCACAAGCCACGCCTCACCACCAAGAGGCCCAACACCTTCTTCTAGGTGCAGGGCCCTTGCCTGGGTGGGCCCCAAATAAACTCAGGAACGCCCCGGTGA
>NM_000980.4
AGAGGACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGAGAGTACAAGGTAGTGGGTCGCTGCCTGCCCACCCCCAAATGCCACACGCCGCCCCTCTACCGCATGCGAATCTTTGCGCCTAATCATGTCGTCGCCAAGTCCCGCTTCTGGTACTTTGTATCTCAGTTAAAGAAGATGAAGAAGTCTTCAGGGGAGATTGTCTACTGTGGGCAGGTGTTTGAGAAGTCCCCCCTGCGGGTGAAGAACTTCGGGATCTGGCTGCGCTATGACTCCCGGAGCGGCACCCACAACATGTACCGGGAATACCGGGACCTGACCACCGCAGGCGCTGTCACCCAGTGCTACCGAGACATGGGTGCCCGGCACCGCGCCCGAGCCCACTCCATTCAGATCATGAAGGTGGAGGAGATCGCGGCCAGCAAGTGCCGCCGGCCGGCTGTCAAGCAGTTCCACGACTCCAAGATCAAGTTCCCGCTGCCCCACCGGGTCCTGCGCCGTCAGCACAAGCCACGCTTCACCACCAAGAGGCCCAACACCTTCTTCTAGGTGCAGGGCCCTCGTCCGGGTGTGCCCCAAATAAACTCAGGAACGCCCCGGTGCTC

Publications

PMID - Link Title