Retrocopy Name | RPL18AP16 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chrX:153662126-153662741 UCSC | |
Coordinates (T2T) | chrX:151935791-151936406 UCSC | |
Coordinates (hg19) | chrX:152927581-152928196 UCSC | |
Strand | + | |
Parental Sequence | NM_000980.4 | |
Parental seq. overlap | 576 bp | |
Parental seq. overlap (%) | 90.9% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | RPL18AP16, located on chrX:153662126-153662741, is a retrocopy of the parental gene RPL18A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | RPL18A |
Full Name | ribosomal protein L18a |
Also known as | L18A |
Coordinate | chr19:17859910-17863319 |
Strand | + |
Gene summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18AE family of ribosomal proteins that is a component of the 60S subunit. The encoded protein may play a role in viral replication by interacting with the hepatitis C virus internal ribosome entry site (IRES). This gene is co-transcribed with the U68 snoRNA, located within the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RPL18AP16 |
![]() |
Bonobo | Pan paniscus | RPL18AP15 |
![]() |
Gorilla | Gorilla gorilla | RPL18AP12 |
![]() |
Orangutan | Pongo abelii | RPL18AP14 |
![]() |
Gibbon | Nomascus leucogenys | RPL18AP11 |
![]() |
Green monkey | Chlorocebus sabaeus | RPL18AP13 |
![]() |
Rhesus | Macaca mulatta | LOC719242P11 |
![]() |
Baboon | Papio anubis | RPL18AP13 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | RPL18AP7 |
![]() |
Marmoset | Callithrix jacchus | RPL18AP11 |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>RPL18AP16 |
cCTTTTGCGGGTGGCGGCGAGCGCAGAGGACGCCATGAAGGCCCCGGGCACACGACTAGAGTACCAGGTGGTGGGTCGCTGCCTGCCCGCCCCCAAATGCCACACACCGCCCCTCTACCGCATGCGAATCTTTGCTCCTAATCATGTCGTCGCTAAGTCCCACTTCTGGTACTTCGTATCTCAGTTAAAGAAGCTGAAGAAGTCTTCAGGGGAGATTGTCTACTGTGGGCAGGTGTTTGAGAAGCGCCCCCTGCGGGTGAAGAACTTCGGCATCTGGCTGCGCTATGACTCCCGGCGCGGCACCCACAACATATACCGGGAATACCGGGACCTGACCACCGCGGGCGCTGTCACCAAGTGCTATCGAGACATGGGCGCCCGGCACCGCGCCCGGGCCCACTCCATCCAGATCAGGAAGGTGGAGGACATCGCAGCCAGCAAGTGCCGCCGGCCGACCGTCAAGCAGTTCCACGACTCCAAGATCAAGTTCCCGCTGCCCCACAGGGTCCTGCGCCGTCAGCACAAACCACGCTTCACCACCAAGAGGCCCGATACCTTCTTCTAAGGGCAGGGCCCTCGCCCGGGTGTGCCCCAAATAAACTCAGGAACGCCCC |
>NM_000980.4 |
AGAGGACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGAGAGTACAAGGTAGTGGGTCGCTGCCTGCCCACCCCCAAATGCCACACGCCGCCCCTCTACCGCATGCGAATCTTTGCGCCTAATCATGTCGTCGCCAAGTCCCGCTTCTGGTACTTTGTATCTCAGTTAAAGAAGATGAAGAAGTCTTCAGGGGAGATTGTCTACTGTGGGCAGGTGTTTGAGAAGTCCCCCCTGCGGGTGAAGAACTTCGGGATCTGGCTGCGCTATGACTCCCGGAGCGGCACCCACAACATGTACCGGGAATACCGGGACCTGACCACCGCAGGCGCTGTCACCCAGTGCTACCGAGACATGGGTGCCCGGCACCGCGCCCGAGCCCACTCCATTCAGATCATGAAGGTGGAGGAGATCGCGGCCAGCAAGTGCCGCCGGCCGGCTGTCAAGCAGTTCCACGACTCCAAGATCAAGTTCCCGCTGCCCCACCGGGTCCTGCGCCGTCAGCACAAGCCACGCTTCACCACCAAGAGGCCCAACACCTTCTTCTAGGTGCAGGGCCCTCGTCCGGGTGTGCCCCAAATAAACTCAGGAACGCCCCGGTGCTC |
PMID - Link | Title |
---|