Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name SLIRP
Plot displaying the genomic locations of a parental gene (in chr14) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name SRA stem-loop interacting RNA binding protein
Also known as C14orf156|DC50|PD04872
Coordinate chr14:77708071-77717598
Strand +
Gene summary Steroid receptor RNA activator (SRA, or SRA1; MIM 603819) is a complex RNA molecule containing multiple stable stem-loop structures that functions in coactivation of nuclear receptors. SLIRP interacts with stem-loop structure-7 of SRA (STR7) and modulates nuclear receptor transactivation (Hatchell et al., 2006 [PubMed 16762838]).[supplied by OMIM, Mar 2008]

Retrocopy(s) from SLIRP

Retroname Coord Strand Genomic Region ENSG
SLIRPP2 chr4:25686160-25686369 - Intergenic
 ENSG00000249277 UCSC
SLIRPP1 chrX:147801036-147801347 + Intergenic
 ENSG00000227505 UCSC

Expression

Transcript Sequences

>NM_031210.6
AGTCTGAAGATGGCGGCCTCAGCAGCGAGAGGTGCTGCGGCGCTGCGTAGAAGTATCAATCAGCCGGTTGCTTTTGTGAGAAGAATTCCTTGGACTGCGGCGTCGAGTCAGCTGAAAGAACACTTTGCACAGTTCGGCCATGTCAGAAGGTGCATTTTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAAGAAGGACTTCGGAATGCACTACAACAGGAAAATCATATTATAGATGGAGTAAAGGTCCAGGTTCACACTAGAAGGCCAAAACTTCCGCAAACATCTGATGATGAAAAGAAAGATTTTTGAGACTGCAGCCTATTAATAAAGTTAACATAACTGAGAA