Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name SLIRPP1
Plot displaying the genomic locations of a retrocopy (in chrX) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chrX:147801036-147801347  UCSC
Coordinates (T2T) chrX:146065671-146065982  UCSC
Coordinates (hg19) chrX:146882554-146882865  UCSC
Strand +
Parental Sequence NM_031210.6
Parental seq. overlap 273 bp
Parental seq. overlap (%) 70.7%
Genomic Region Intergenic
Retrocopy Summary SLIRPP1, located on chrX:147801036-147801347, is a retrocopy of the parental gene SLIRP. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name SLIRP
Full Name SRA stem-loop interacting RNA binding protein
Also known as C14orf156|DC50|PD04872
Coordinate chr14:77708071-77717598
Strand +
Gene summary Steroid receptor RNA activator (SRA, or SRA1; MIM 603819) is a complex RNA molecule containing multiple stable stem-loop structures that functions in coactivation of nuclear receptors. SLIRP interacts with stem-loop structure-7 of SRA (STR7) and modulates nuclear receptor transactivation (Hatchell et al., 2006 [PubMed 16762838]).[supplied by OMIM, Mar 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes SLIRPP2
Bonobo Pan paniscus SLIRPP2
Gorilla Gorilla gorilla SLIRPP2
Orangutan Pongo abelii SLIRPP2
Gibbon Nomascus leucogenys SLIRPP3
Green monkey Chlorocebus sabaeus SLIRPP2
Crab-eating macaque Macaca fascicularis SLIRPP2
Rhesus Macaca mulatta SLIRPP2
Baboon Papio anubis SLIRPP2
Marmoset Callithrix jacchus SLIRPP8
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>SLIRPP1
GGCCGGTTGCTTTTGTTAGCAAAATTCCTTGGACCGCAGCGTCAAATCAGCTGATGGTGTCTTTGCACAGTTTGGCCATATCCAAAAATGTGTTGTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAAGAACTTCAGAATGCACTATAACAGGAAAATCATATTATAGATGGAGTAAAGCTCCAGATTGGAGCTCAAAGGCCAAAAGTTTTGTAAACATCTGATGAAGAGAAAGATTTTTGAGACTATTTCAGCCTATTAAATAAAGTTAACATAACTGAGAA
>NM_031210.6
AGTCTGAAGATGGCGGCCTCAGCAGCGAGAGGTGCTGCGGCGCTGCGTAGAAGTATCAATCAGCCGGTTGCTTTTGTGAGAAGAATTCCTTGGACTGCGGCGTCGAGTCAGCTGAAAGAACACTTTGCACAGTTCGGCCATGTCAGAAGGTGCATTTTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAAGAAGGACTTCGGAATGCACTACAACAGGAAAATCATATTATAGATGGAGTAAAGGTCCAGGTTCACACTAGAAGGCCAAAACTTCCGCAAACATCTGATGATGAAAAGAAAGATTTTTGAGACTGCAGCCTATTAATAAAGTTAACATAACTGAGAA

Publications

PMID - Link Title