Retrocopy Name | SLIRPP1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chrX:147801036-147801347 UCSC | |
Coordinates (T2T) | chrX:146065671-146065982 UCSC | |
Coordinates (hg19) | chrX:146882554-146882865 UCSC | |
Strand | + | |
Parental Sequence | NM_031210.6 | |
Parental seq. overlap | 273 bp | |
Parental seq. overlap (%) | 70.7% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | SLIRPP1, located on chrX:147801036-147801347, is a retrocopy of the parental gene SLIRP. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | SLIRP |
Full Name | SRA stem-loop interacting RNA binding protein |
Also known as | C14orf156|DC50|PD04872 |
Coordinate | chr14:77708071-77717598 |
Strand | + |
Gene summary | Steroid receptor RNA activator (SRA, or SRA1; MIM 603819) is a complex RNA molecule containing multiple stable stem-loop structures that functions in coactivation of nuclear receptors. SLIRP interacts with stem-loop structure-7 of SRA (STR7) and modulates nuclear receptor transactivation (Hatchell et al., 2006 [PubMed 16762838]).[supplied by OMIM, Mar 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | SLIRPP2 |
![]() |
Bonobo | Pan paniscus | SLIRPP2 |
![]() |
Gorilla | Gorilla gorilla | SLIRPP2 |
![]() |
Orangutan | Pongo abelii | SLIRPP2 |
![]() |
Gibbon | Nomascus leucogenys | SLIRPP3 |
![]() |
Green monkey | Chlorocebus sabaeus | SLIRPP2 |
![]() |
Crab-eating macaque | Macaca fascicularis | SLIRPP2 |
![]() |
Rhesus | Macaca mulatta | SLIRPP2 |
![]() |
Baboon | Papio anubis | SLIRPP2 |
![]() |
Marmoset | Callithrix jacchus | SLIRPP8 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>SLIRPP1 |
GGCCGGTTGCTTTTGTTAGCAAAATTCCTTGGACCGCAGCGTCAAATCAGCTGATGGTGTCTTTGCACAGTTTGGCCATATCCAAAAATGTGTTGTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAAGAACTTCAGAATGCACTATAACAGGAAAATCATATTATAGATGGAGTAAAGCTCCAGATTGGAGCTCAAAGGCCAAAAGTTTTGTAAACATCTGATGAAGAGAAAGATTTTTGAGACTATTTCAGCCTATTAAATAAAGTTAACATAACTGAGAA |
>NM_031210.6 |
AGTCTGAAGATGGCGGCCTCAGCAGCGAGAGGTGCTGCGGCGCTGCGTAGAAGTATCAATCAGCCGGTTGCTTTTGTGAGAAGAATTCCTTGGACTGCGGCGTCGAGTCAGCTGAAAGAACACTTTGCACAGTTCGGCCATGTCAGAAGGTGCATTTTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAAGAAGGACTTCGGAATGCACTACAACAGGAAAATCATATTATAGATGGAGTAAAGGTCCAGGTTCACACTAGAAGGCCAAAACTTCCGCAAACATCTGATGATGAAAAGAAAGATTTTTGAGACTGCAGCCTATTAATAAAGTTAACATAACTGAGAA |
PMID - Link | Title |
---|