Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name SLIRPP2
Wait
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:25686160-25686369  UCSC
Coordinates (T2T) chr4:25668132-25668341  UCSC
Coordinates (hg19) chr4:25687782-25687991  UCSC
Strand -
Parental Sequence NM_031210.6
Parental seq. overlap 189 bp
Parental seq. overlap (%) 49.6%
Genomic Region Intergenic
Retrocopy Summary SLIRPP2, located on chr4:25686160-25686369, is a retrocopy of the parental gene SLIRP. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name SLIRP
Full Name SRA stem-loop interacting RNA binding protein
Also known as C14orf156|DC50|PD04872
Coordinate chr14:77708071-77717598
Strand +
Gene summary Steroid receptor RNA activator (SRA, or SRA1; MIM 603819) is a complex RNA molecule containing multiple stable stem-loop structures that functions in coactivation of nuclear receptors. SLIRP interacts with stem-loop structure-7 of SRA (STR7) and modulates nuclear receptor transactivation (Hatchell et al., 2006 [PubMed 16762838]).[supplied by OMIM, Mar 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes SLIRPP1
Bonobo Pan paniscus SLIRPP1
Gorilla Gorilla gorilla SLIRPP1
Orangutan Pongo abelii SLIRPP1
Green monkey Chlorocebus sabaeus SLIRPP1
Crab-eating macaque Macaca fascicularis SLIRPP1
Rhesus Macaca mulatta SLIRPP1
Baboon Papio anubis SLIRPP1
Golden snub-nosed monkey Rhinopithecus roxellana SLIRPP1
Marmoset Callithrix jacchus SLIRPP3
Gibbon Nomascus leucogenys Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.20.4
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth00.511.5
log10(TPM+1)

Related Sequence

>SLIRPP2
GACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTGTTCTTCAGAACTTCAGAATGCACTACAGCAGGAATATCATATTATAGGTGGAGTAAAGCTCCAGGTTTAAGCTCAAAGGCCAAAAGTTTTGCAAACATCTGATGATGAAGAGAAAGATTTTTGAGACTGTTTCAGCTTATTAAATAAAGTTAACATAACTGAGAAA
>NM_031210.6
AGTCTGAAGATGGCGGCCTCAGCAGCGAGAGGTGCTGCGGCGCTGCGTAGAAGTATCAATCAGCCGGTTGCTTTTGTGAGAAGAATTCCTTGGACTGCGGCGTCGAGTCAGCTGAAAGAACACTTTGCACAGTTCGGCCATGTCAGAAGGTGCATTTTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAAGAAGGACTTCGGAATGCACTACAACAGGAAAATCATATTATAGATGGAGTAAAGGTCCAGGTTCACACTAGAAGGCCAAAACTTCCGCAAACATCTGATGATGAAAAGAAAGATTTTTGAGACTGCAGCCTATTAATAAAGTTAACATAACTGAGAA

Publications

PMID - Link Title
9847074Toward a complete human genome sequence.