Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name BANF1
Plot displaying the genomic locations of a parental gene (in chr11) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name BAF nuclear assembly factor 1
Also known as BAF|BCRP1|D14S1460|NGPS
Coordinate chr11:66002079-66004149
Strand +
Gene summary The protein encoded by this gene was first identified by its ability to protect retroviruses from intramolecular integration and therefore promote intermolecular integration into the host cell genome. The protein forms a homodimer which localizes to both the nucleus and cytoplasm and is specifically associated with chromosomes during mitosis. This protein binds to double stranded DNA in a non-specific manner and also binds to LEM-domain containing proteins of the nuclear envelope. This protein is thought to facilitate nuclear reassembly by binding with both DNA and inner nuclear membrane proteins and thereby recruit chromatin to the nuclear periphery. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Jan 2009]

Retrocopy(s) from BANF1

Retroname Coord Strand Genomic Region ENSG
BANF1P2 chr10:133344274-133344990 - Intergenic
 ENSG00000230306 UCSC
BANF1P4 chr1:174756477-174757203 - Intragenic
 ENSG00000223828 UCSC
BANF1P1 chr14:68936546-68937235 + Intergenic
 ENSG00000258531 UCSC
BANF1P3 chr2:230724768-230725479 - Intragenic
 ENSG00000237758 UCSC
BANF1P5 chr7:107642650-107643059 - Intergenic
 ENSG00000225935 UCSC

Expression

Transcript Sequences

>NM_003860.4
AGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTGGGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGACAAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGGGAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGATGCTCTCTGGGAAGCTCTCAATCCCCAGCCCTCATCCAGAGTTTGCAGCCGAGTAGGGACTCCTCCCCTGTCCTCTACGAAGGAAAAGATTGCTATTGTCGTACTCACCTCCGACGTACTCCGGGGTCTTTTGGGAGTTTTCTCCCCTAACCATTTCAACTTTTTTTTGGATTCTCGCTCTTGCATGCCTCCCCCGTCCTTTTTCCCTTGCCAGTTCCCTGGTGACAGTTACCAGCTTTCCTGAATGGATTCCCGGCCCCATCCCTCACCCCCACCCTCACTTTCAATCCGTTTGATACCATTTGGCTCCTTTTTTGGCAGAACAGTCACTGTCCTTGTAAAGTTTTTTAGATCAATAAAGTCAGTGGCTTTCATGA