Retrocopy Name | BANF1P5 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr7:107642650-107643059 UCSC | |
Coordinates (T2T) | chr7:108958787-108959196 UCSC | |
Coordinates (hg19) | chr7:107283095-107283504 UCSC | |
Strand | - | |
Parental Sequence | NM_003860.4 | |
Parental seq. overlap | 355 bp | |
Parental seq. overlap (%) | 47.7% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | BANF1P5, located on chr7:107642650-107643059, is a retrocopy of the parental gene BANF1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | BANF1 |
Full Name | BAF nuclear assembly factor 1 |
Also known as | BAF|BCRP1|D14S1460|NGPS |
Coordinate | chr11:66002079-66004149 |
Strand | + |
Gene summary | The protein encoded by this gene was first identified by its ability to protect retroviruses from intramolecular integration and therefore promote intermolecular integration into the host cell genome. The protein forms a homodimer which localizes to both the nucleus and cytoplasm and is specifically associated with chromosomes during mitosis. This protein binds to double stranded DNA in a non-specific manner and also binds to LEM-domain containing proteins of the nuclear envelope. This protein is thought to facilitate nuclear reassembly by binding with both DNA and inner nuclear membrane proteins and thereby recruit chromatin to the nuclear periphery. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Jan 2009] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | BANF1P3 |
![]() |
Bonobo | Pan paniscus | BANF1P3 |
![]() |
Gorilla | Gorilla gorilla | BANF1P3 |
![]() |
Orangutan | Pongo abelii | BANF1P2 |
![]() |
Gibbon | Nomascus leucogenys | BANF1P4 |
![]() |
Green monkey | Chlorocebus sabaeus | BANF1P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | BANF1P2 |
![]() |
Rhesus | Macaca mulatta | BANF1P2 |
![]() |
Baboon | Papio anubis | BANF1P3 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | BANF1P2 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>BANF1P5 |
GTTATGGGAACTGGAGCTGCTGATTAAGCTTGATTAAGATGACAACCTCCCAAAAGCACTGAGGCTTCACGGCAGAGCCTATGGGGGAAAACCAGTGGGGAGCCTGGCCAGTATTGGTGAAGTGCTGGGCAAGAAGCTGGAGGAAAGGGGCTTTGACAAGGCCTGTGTTGTCCTTGGCTGGTGCTAAAGAAAGAGGAAGATCTTGCCCAGGTATGGCTGAAGGACACAAGTAGCACCAAAGCCAAGCAGCCCCAGGACTGCTTTGGATGCATTCAAGAGTGGTGTGACGCCTTCTTGTGATGCTTTCTGGGAAGCCCTCAATGCCCAGCCCCAGCATTGCGTCTCCAGAGTTTGCAGCCAAGTAGGGGACTCCTCCTCTGTCCTCTACAAAGGAAATGATTGCTGTTGTT |
>NM_003860.4 |
AGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTGGGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGACAAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGGGAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGATGCTCTCTGGGAAGCTCTCAATCCCCAGCCCTCATCCAGAGTTTGCAGCCGAGTAGGGACTCCTCCCCTGTCCTCTACGAAGGAAAAGATTGCTATTGTCGTACTCACCTCCGACGTACTCCGGGGTCTTTTGGGAGTTTTCTCCCCTAACCATTTCAACTTTTTTTTGGATTCTCGCTCTTGCATGCCTCCCCCGTCCTTTTTCCCTTGCCAGTTCCCTGGTGACAGTTACCAGCTTTCCTGAATGGATTCCCGGCCCCATCCCTCACCCCCACCCTCACTTTCAATCCGTTTGATACCATTTGGCTCCTTTTTTGGCAGAACAGTCACTGTCCTTGTAAAGTTTTTTAGATCAATAAAGTCAGTGGCTTTCATGA |
PMID - Link | Title |
---|