Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name BANF1P5
Wait
Plot displaying the genomic locations of a retrocopy (in chr7) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr7:107642650-107643059  UCSC
Coordinates (T2T) chr7:108958787-108959196  UCSC
Coordinates (hg19) chr7:107283095-107283504  UCSC
Strand -
Parental Sequence NM_003860.4
Parental seq. overlap 355 bp
Parental seq. overlap (%) 47.7%
Genomic Region Intergenic
Retrocopy Summary BANF1P5, located on chr7:107642650-107643059, is a retrocopy of the parental gene BANF1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name BANF1
Full Name BAF nuclear assembly factor 1
Also known as BAF|BCRP1|D14S1460|NGPS
Coordinate chr11:66002079-66004149
Strand +
Gene summary The protein encoded by this gene was first identified by its ability to protect retroviruses from intramolecular integration and therefore promote intermolecular integration into the host cell genome. The protein forms a homodimer which localizes to both the nucleus and cytoplasm and is specifically associated with chromosomes during mitosis. This protein binds to double stranded DNA in a non-specific manner and also binds to LEM-domain containing proteins of the nuclear envelope. This protein is thought to facilitate nuclear reassembly by binding with both DNA and inner nuclear membrane proteins and thereby recruit chromatin to the nuclear periphery. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Jan 2009]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes BANF1P3
Bonobo Pan paniscus BANF1P3
Gorilla Gorilla gorilla BANF1P3
Orangutan Pongo abelii BANF1P2
Gibbon Nomascus leucogenys BANF1P4
Green monkey Chlorocebus sabaeus BANF1P1
Crab-eating macaque Macaca fascicularis BANF1P2
Rhesus Macaca mulatta BANF1P2
Baboon Papio anubis BANF1P3
Golden snub-nosed monkey Rhinopithecus roxellana BANF1P2
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.20.4
log10(TPM+1)

Related Sequence

>BANF1P5
GTTATGGGAACTGGAGCTGCTGATTAAGCTTGATTAAGATGACAACCTCCCAAAAGCACTGAGGCTTCACGGCAGAGCCTATGGGGGAAAACCAGTGGGGAGCCTGGCCAGTATTGGTGAAGTGCTGGGCAAGAAGCTGGAGGAAAGGGGCTTTGACAAGGCCTGTGTTGTCCTTGGCTGGTGCTAAAGAAAGAGGAAGATCTTGCCCAGGTATGGCTGAAGGACACAAGTAGCACCAAAGCCAAGCAGCCCCAGGACTGCTTTGGATGCATTCAAGAGTGGTGTGACGCCTTCTTGTGATGCTTTCTGGGAAGCCCTCAATGCCCAGCCCCAGCATTGCGTCTCCAGAGTTTGCAGCCAAGTAGGGGACTCCTCCTCTGTCCTCTACAAAGGAAATGATTGCTGTTGTT
>NM_003860.4
AGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTGGGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGACAAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGGGAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGATGCTCTCTGGGAAGCTCTCAATCCCCAGCCCTCATCCAGAGTTTGCAGCCGAGTAGGGACTCCTCCCCTGTCCTCTACGAAGGAAAAGATTGCTATTGTCGTACTCACCTCCGACGTACTCCGGGGTCTTTTGGGAGTTTTCTCCCCTAACCATTTCAACTTTTTTTTGGATTCTCGCTCTTGCATGCCTCCCCCGTCCTTTTTCCCTTGCCAGTTCCCTGGTGACAGTTACCAGCTTTCCTGAATGGATTCCCGGCCCCATCCCTCACCCCCACCCTCACTTTCAATCCGTTTGATACCATTTGGCTCCTTTTTTGGCAGAACAGTCACTGTCCTTGTAAAGTTTTTTAGATCAATAAAGTCAGTGGCTTTCATGA

Publications

PMID - Link Title
No publications available for this retrocopy