Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name ATP6V1F
Plot displaying the genomic locations of a parental gene (in chr7) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name ATPase H+ transporting V1 subunit F
Also known as ATP6S14|VATF|Vma7
Coordinate chr7:128862856-128865847
Strand +
Gene summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is the V1 domain F subunit protein. [provided by RefSeq, Jul 2008]

Retrocopy(s) from ATP6V1F

Retroname Coord Strand Genomic Region ENSG
ATP6V1FP2 chr12:48085017-48085595 + Intragenic
ENSG00000226138 UCSC
ATP6V1FP1 chr6:34715612-34716101 + Intergenic
ENSG00000186328 UCSC

Expression

Transcript Sequences

>NM_004231.4
GTTTCAGTGGCTTCTGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCGCAGTGATCGGAGACGAGGACACGGTGACTGGTTTCCTGCTGGGCGGCATAGGGGAGCTTAACAAGAACCGCCATCCCAATTTCCTGGTGGTGGAGAAGGATACAACCATCAATGAGATCGAAGACACTTTCCGGCAATTTCTAAACCGGGATGACATTGGCATCATCCTCATCAACCAGTACATCGCAGAGATGGTGCGGCATGCCCTGGACGCCCACCAGCAGTCCATCCCCGCTGTCCTGGAGATCCCCTCCAAGGAGCACCCATATGACGCCGCCAAGGACTCCATCCTGCGCAGGGCCAGGGGCATGTTCACTGCCGAAGACCTGCGCTAGGGGACTCCTCATAGCCCTCAGCCCTTCCCTCGTTTCCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTACTTTTTGAGCCTCTGATTTCCAATTCCCTGCTCCTTCCCACTCCATTAAGAGGCTAGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGCTGGTTAAGGAACAGGAAGCCTGACCATCTCCCTCCACTACCTCTTCCCTGTGCTGTTACACAGTGTCATTGTTGATGTTAAATTAAAGTCATATTCTTGCTTCTCTCCA