| Retrocopy Name | ATP6V1FP1 | 
                 | 
        
| Species | Homo sapiens | |
| Coordinates (hg38) | chr6:34715612-34716101 UCSC | |
| Coordinates (T2T) | chr6:34539583-34540072 UCSC | |
| Coordinates (hg19) | chr6:34683389-34683878 UCSC | |
| Strand | + | |
| Parental Sequence | NM_004231.4 | |
| Parental seq. overlap | 428 bp | |
| Parental seq. overlap (%) | 62.9% | |
| Genomic Region | 
									Intergenic | 
        |
| Retrocopy Summary | ATP6V1FP1, located on chr6:34715612-34716101, is a retrocopy of the parental gene ATP6V1F. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. | 
| Gene Name | ATP6V1F | 
| Full Name | ATPase H+ transporting V1 subunit F | 
| Also known as | ATP6S14|VATF|Vma7 | 
| Coordinate | chr7:128862856-128865847 | 
| Strand | + | 
| Gene summary | This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is the V1 domain F subunit protein. [provided by RefSeq, Jul 2008] | 
| Species | Scientific Name | Retrocopy | |
![]()  | 
			Chimpanzee | Pan troglodytes | ATP6V1FP1 | 
![]()  | 
			Bonobo | Pan paniscus | ATP6V1FP1 | 
![]()  | 
			Gorilla | Gorilla gorilla | ATP6V1FP1 | 
![]()  | 
			Orangutan | Pongo abelii | ATP6V1FP1 | 
![]()  | 
			Gibbon | Nomascus leucogenys | ATP6V1FP2 | 
![]()  | 
			Green monkey | Chlorocebus sabaeus | ATP6V1FP2 | 
![]()  | 
			Crab-eating macaque | Macaca fascicularis | ATP6V1FP1 | 
![]()  | 
			Rhesus | Macaca mulatta | ATP6V1FP1 | 
![]()  | 
			Baboon | Papio anubis | ATP6V1FP1 | 
![]()  | 
			Golden snub-nosed monkey | Rhinopithecus roxellana | ATP6V1FP1 | 
![]()  | 
			Marmoset | Callithrix jacchus | ATP6V1FP1 | 
![]()  | 
			Mouse lemur | Microcebus murinus | Without Homology | 
![]()  | 
			Mouse | Mus musculus | Without Homology | 
![]()  | 
			Rat | Rattus norvegicus | Without Homology | 
![]()  | 
			Chinese hamster | Cricetulus griseus | Without Homology | 
![]()  | 
			Rabbit | Oryctolagus cuniculus | Without Homology | 
![]()  | 
			Pig | Sus scrofa | Without Homology | 
![]()  | 
			Cow | Bos taurus | Without Homology | 
![]()  | 
			Sheep | Ovis aries | Without Homology | 
![]()  | 
			Dolphin | Tursiops truncatus | Without Homology | 
![]()  | 
			Horse | Equus caballus | Without Homology | 
![]()  | 
			Dog | Canis familiaris | Without Homology | 
![]()  | 
			Panda | Ailuropoda melanoleuca | Without Homology | 
![]()  | 
			Cat | Felis catus | Without Homology | 
![]()  | 
			Pale spear-nosed bat | Phyllostomus discolor | Without Homology | 
![]()  | 
			Velvety free-tailed bat | Molossus molossus | Without Homology | 
![]()  | 
			Greater mouse-eared bat | Myotis myotis | Without Homology | 
![]()  | 
			Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology | 
![]()  | 
			Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology | 
![]()  | 
			Egyptian rousette | Rousettus aegyptiacus | Without Homology | 
![]()  | 
			Sloth | Choloepus didactylus | Without Homology | 
![]()  | 
			Tasmanian Devil | Sarcophilus harrisii | Without Homology | 
![]()  | 
			Opossum | Monodelphis domestica | Without Homology | 
![]()  | 
			Platypus | Ornithorhynchus anatinus | Without Homology | 
![]()  | 
			Chicken | Gallus gallus | Without Homology | 
![]()  | 
			Turkey | Meleagris gallopavo | Without Homology | 
![]()  | 
			Zebra Finch | Taeniopygia guttata | Without Homology | 
![]()  | 
			Budgerigar | Melopsittacus undulatus | Without Homology | 
![]()  | 
			Painted Turtle | Chrysemys picta | Without Homology | 
![]()  | 
			Lizard | Anolis Carolinensis | Without Homology | 
![]()  | 
			Frog | Xenopus tropicalis | Without Homology | 
![]()  | 
			Zebrafish | Danio rerio | Without Homology | 
![]()  | 
			Drosophila | Drosophila melanogaster | Without Homology | 
| >ATP6V1FP1 | 
| TGGAGACCAGGACACGGTGACTGCTTTCCTGCCGGGTGGCATAGGGGAGCTTAACAAGAACTACTATCCCAATTTCCTGATGGTGGAGAAGCATACAACCATCAGTGAGATCAAAGACACTTTCCAGCAGTTTCTGAACGGGACAACATTGGCATCATCCTCATCAACCTGTACATTACAGAGATGGTGTGGCACGCCTTGGATACACACCAGTGCCCCATTCCAGTCATCCTGGAGATCCCCTCCGAGGAGCACCCGTATGACACTGTGCCAAGGAATCCATCCTGGGCAGAGCCAGGGACATGTTCTCTGCCGAAGACCTGCGCTAGGGGATTCCTCACAGCCCAAAGCCCCTCCCTCATTTCCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTAAGTTCTGAGCCTCTGACTTCCAATTCCCACCTCTTCCCACTTCATTAAGAGGCTAGGTGAGGCGCTCCTAGGGTGCTTGGGCTCTGCTG | 
| >NM_004231.4 | 
| GTTTCAGTGGCTTCTGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCGCAGTGATCGGAGACGAGGACACGGTGACTGGTTTCCTGCTGGGCGGCATAGGGGAGCTTAACAAGAACCGCCATCCCAATTTCCTGGTGGTGGAGAAGGATACAACCATCAATGAGATCGAAGACACTTTCCGGCAATTTCTAAACCGGGATGACATTGGCATCATCCTCATCAACCAGTACATCGCAGAGATGGTGCGGCATGCCCTGGACGCCCACCAGCAGTCCATCCCCGCTGTCCTGGAGATCCCCTCCAAGGAGCACCCATATGACGCCGCCAAGGACTCCATCCTGCGCAGGGCCAGGGGCATGTTCACTGCCGAAGACCTGCGCTAGGGGACTCCTCATAGCCCTCAGCCCTTCCCTCGTTTCCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTACTTTTTGAGCCTCTGATTTCCAATTCCCTGCTCCTTCCCACTCCATTAAGAGGCTAGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGCTGGTTAAGGAACAGGAAGCCTGACCATCTCCCTCCACTACCTCTTCCCTGTGCTGTTACACAGTGTCATTGTTGATGTTAAATTAAAGTCATATTCTTGCTTCTCTCCA | 
| PMID - Link | Title | 
|---|