Retrocopy Name | ATP6V1FP1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr6:34715612-34716101 UCSC | |
Coordinates (T2T) | chr6:34539583-34540072 UCSC | |
Coordinates (hg19) | chr6:34683389-34683878 UCSC | |
Strand | + | |
Parental Sequence | NM_004231.4 | |
Parental seq. overlap | 428 bp | |
Parental seq. overlap (%) | 62.9% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | ATP6V1FP1, located on chr6:34715612-34716101, is a retrocopy of the parental gene ATP6V1F. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | ATP6V1F |
Full Name | ATPase H+ transporting V1 subunit F |
Also known as | ATP6S14|VATF|Vma7 |
Coordinate | chr7:128862856-128865847 |
Strand | + |
Gene summary | This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is the V1 domain F subunit protein. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | ATP6V1FP1 |
![]() |
Bonobo | Pan paniscus | ATP6V1FP1 |
![]() |
Gorilla | Gorilla gorilla | ATP6V1FP1 |
![]() |
Orangutan | Pongo abelii | ATP6V1FP1 |
![]() |
Gibbon | Nomascus leucogenys | ATP6V1FP2 |
![]() |
Green monkey | Chlorocebus sabaeus | ATP6V1FP2 |
![]() |
Crab-eating macaque | Macaca fascicularis | ATP6V1FP1 |
![]() |
Rhesus | Macaca mulatta | ATP6V1FP1 |
![]() |
Baboon | Papio anubis | ATP6V1FP1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | ATP6V1FP1 |
![]() |
Marmoset | Callithrix jacchus | ATP6V1FP1 |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>ATP6V1FP1 |
TGGAGACCAGGACACGGTGACTGCTTTCCTGCCGGGTGGCATAGGGGAGCTTAACAAGAACTACTATCCCAATTTCCTGATGGTGGAGAAGCATACAACCATCAGTGAGATCAAAGACACTTTCCAGCAGTTTCTGAACGGGACAACATTGGCATCATCCTCATCAACCTGTACATTACAGAGATGGTGTGGCACGCCTTGGATACACACCAGTGCCCCATTCCAGTCATCCTGGAGATCCCCTCCGAGGAGCACCCGTATGACACTGTGCCAAGGAATCCATCCTGGGCAGAGCCAGGGACATGTTCTCTGCCGAAGACCTGCGCTAGGGGATTCCTCACAGCCCAAAGCCCCTCCCTCATTTCCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTAAGTTCTGAGCCTCTGACTTCCAATTCCCACCTCTTCCCACTTCATTAAGAGGCTAGGTGAGGCGCTCCTAGGGTGCTTGGGCTCTGCTG |
>NM_004231.4 |
GTTTCAGTGGCTTCTGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCGCAGTGATCGGAGACGAGGACACGGTGACTGGTTTCCTGCTGGGCGGCATAGGGGAGCTTAACAAGAACCGCCATCCCAATTTCCTGGTGGTGGAGAAGGATACAACCATCAATGAGATCGAAGACACTTTCCGGCAATTTCTAAACCGGGATGACATTGGCATCATCCTCATCAACCAGTACATCGCAGAGATGGTGCGGCATGCCCTGGACGCCCACCAGCAGTCCATCCCCGCTGTCCTGGAGATCCCCTCCAAGGAGCACCCATATGACGCCGCCAAGGACTCCATCCTGCGCAGGGCCAGGGGCATGTTCACTGCCGAAGACCTGCGCTAGGGGACTCCTCATAGCCCTCAGCCCTTCCCTCGTTTCCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTACTTTTTGAGCCTCTGATTTCCAATTCCCTGCTCCTTCCCACTCCATTAAGAGGCTAGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGCTGGTTAAGGAACAGGAAGCCTGACCATCTCCCTCCACTACCTCTTCCCTGTGCTGTTACACAGTGTCATTGTTGATGTTAAATTAAAGTCATATTCTTGCTTCTCTCCA |
PMID - Link | Title |
---|