Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name ATP6V1FP2
Plot displaying the genomic locations of a retrocopy (in chr12) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr12:48085017-48085595  UCSC
Coordinates (T2T) chr12:48046378-48046956  UCSC
Coordinates (hg19) chr12:48478800-48479378  UCSC
Strand +
Parental Sequence NM_004231.4
Parental seq. overlap 535 bp
Parental seq. overlap (%) 77.5%
Genomic Region Intragenic (SENP1)
Retrocopy Summary ATP6V1FP2, located on chr12:48085017-48085595, is a retrocopy of the parental gene ATP6V1F. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP6V1F
Full Name ATPase H+ transporting V1 subunit F
Also known as ATP6S14|VATF|Vma7
Coordinate chr7:128862856-128865847
Strand +
Gene summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is the V1 domain F subunit protein. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP6V1FP2
Bonobo Pan paniscus ATP6V1FP2
Gorilla Gorilla gorilla ATP6V1FP2
Orangutan Pongo abelii ATP6V1FP2
Gibbon Nomascus leucogenys ATP6V1FP1
Green monkey Chlorocebus sabaeus ATP6V1FP1
Crab-eating macaque Macaca fascicularis ATP6V1FP2
Rhesus Macaca mulatta ATP6V1FP2
Baboon Papio anubis ATP6V1FP2
Golden snub-nosed monkey Rhinopithecus roxellana ATP6V1FP2
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP6V1FP2
GAGTGGCTTCTGGTGCTCTGGGGTGAGCTCTGCCTGGCTGCAGGGATGGCGGGGAGAAGGAAGCTCATCGCAGTGATCAGAGACAAGGACACGGTGACTGGTTTCCTGCTGGGCAGCATAGGGGAGCTTAACAAGAACTGCCACCCCAATTTCCTGGTGGTGGAGAAGGATACGACCATCAATGAGATCGAAGACACTTTCCGGCAATTTCTAAACCGGGATGACACTGGCATCATCCTCATCAACCAGTACATCGCAGAGATGGTGCAGCATGCCCTGGACACCCACCAGCACTCTATCCCTACTGTCCTGGAGATCCCCTCCAAGGAGCACCCATATGAGGACGCCAAGGACTCCACCCTGCGGAGGGCCAGGGGCATGTTCACTGCCGAAGACCTGTGCTAGGGTCTTTGTGTGAGGACTCCTCACAGCCCTCAGCCCTTCCCTCATTCTCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTACATTTTGAGCCTCTAATTTCCAAGTCCCTGCCCCTTCCCACTCCATTAAGAGGCTAGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGCTG
>NM_004231.4
GTTTCAGTGGCTTCTGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCGCAGTGATCGGAGACGAGGACACGGTGACTGGTTTCCTGCTGGGCGGCATAGGGGAGCTTAACAAGAACCGCCATCCCAATTTCCTGGTGGTGGAGAAGGATACAACCATCAATGAGATCGAAGACACTTTCCGGCAATTTCTAAACCGGGATGACATTGGCATCATCCTCATCAACCAGTACATCGCAGAGATGGTGCGGCATGCCCTGGACGCCCACCAGCAGTCCATCCCCGCTGTCCTGGAGATCCCCTCCAAGGAGCACCCATATGACGCCGCCAAGGACTCCATCCTGCGCAGGGCCAGGGGCATGTTCACTGCCGAAGACCTGCGCTAGGGGACTCCTCATAGCCCTCAGCCCTTCCCTCGTTTCCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTACTTTTTGAGCCTCTGATTTCCAATTCCCTGCTCCTTCCCACTCCATTAAGAGGCTAGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGCTGGTTAAGGAACAGGAAGCCTGACCATCTCCCTCCACTACCTCTTCCCTGTGCTGTTACACAGTGTCATTGTTGATGTTAAATTAAAGTCATATTCTTGCTTCTCTCCA

Publications

PMID - Link Title