Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL30P11
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr8). Each line represents a retrocopy.
Species Pan paniscus
Coordinates chr8:109182854-109183116  UCSC
Strand +
Parental Sequence XM_034966403.1
Parental seq. overlap 222 bp
Parental seq. overlap (%) 38.7%
Genomic Region Intragenic (CSMD3)
Retrocopy Summary RPL30P11, located on chr8:109182854-109183116, is a retrocopy of the parental gene RPL30. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL30
Full Name N/A
Also known as -
Coordinate chr8:94678823-94682726
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens RPL30P16
Chimpanzee Pan troglodytes RPL30P10
Gorilla Gorilla gorilla RPL30P9
Orangutan Pongo abelii RPL30P10
Gibbon Nomascus leucogenys RPL30P11
Crab-eating macaque Macaca fascicularis RPL30P7
Rhesus Macaca mulatta RPL30P9
Baboon Papio anubis RPL30P10
Golden snub-nosed monkey Rhinopithecus roxellana RPL30P14
Green monkey Chlorocebus sabaeus Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL30P11
AGGTACAAGCCAACTCTGAAGATGATCAGACAAGGCAAAGCAAAATTCATCATCCTTTTTAGAAACTGCCTGACTTTGAAGAAATCTGAATTAGAGTACTAAGTATTGTTGGCCAAAACTGCTATCCACCACTACAGTGGCAATAACACTGAATTGGGTACAGCATGTGAAATATACTACATACAATGCATACTGGCTATCATTAATCCGGGTGATTCTGATATCATTAGAAGCATGCCAGAATAGTCTGGTGAAAAGTAAAC
>XM_034966403.1
atctgtttccgcttccggtcccgcAGTTCCGGCTCGGCCCTGAAGAGCTTTGCATTGTGGGAAGTCTTTCTTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCACCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGACGAAAAAGTCGCTGGAGTCGATCAACTCTAGGCTCCAACTCGTTATGAAAAGTGGGAAGTACGTCCTGGGGTACAAGCAGACTCTGAAGATGATCAGACAAGGCAAAGCGAAATTGGTCATTCTCGCTAACAACTGCCCAGCTTTGAGGAAATCTGAAATAGAGTACTATGCTATGTTGGCTAAAACTGGTGTCCATCACTACAGTGGCAATAATATTGAACTGGGCACAGCATGCGGAAAATACTACAGAGTGTGCACACTGGCTATCATTGATCCAGGTGACTCTGACATCATTAGAAGCATGCCAGAACAGACTGGTGAAAAGTAAACCTTTTCACCTACAAAATTTCACCTGCAAACCTTAAACCTGCAAAATTTTCCTTTAATAAAATTTGCTTGTTTTAAAAACATTG

Publications

PMID - Link Title