Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name LOC102143756P7
Wait
Plot displaying the genomic locations of a retrocopy (in chr16) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Macaca fascicularis
Coordinates chr16:34066131-34066467  UCSC
Strand +
Parental Sequence XM_005588877.2
Parental seq. overlap 279 bp
Parental seq. overlap (%) 63.1%
Genomic Region Intergenic
Retrocopy Summary LOC102143756P7, located on chr16:34066131-34066467, is a retrocopy of the parental gene LOC102143756. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name LOC102143756
Full Name N/A
Also known as COX6B1
Coordinate chr19:36105454-36116040
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens COX6B1P2
Chimpanzee Pan troglodytes COX6B1P5
Bonobo Pan paniscus LOC100972703P5
Gorilla Gorilla gorilla LOC101139203P3
Orangutan Pongo abelii COX6B1P5
Rhesus Macaca mulatta COX6B1P7
Baboon Papio anubis LOC101010708P8
Golden snub-nosed monkey Rhinopithecus roxellana LOC104667089P8
Marmoset Callithrix jacchus LOC100390127P2
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>LOC102143756P7
CCTACAAGACTGCTCCCTTTGACAGCAGCTTCCCCAACCAGAACCAGCCCAGGAACTGCTTGCAGGACTACCTGGACTTTCACCTCTGTGAGAAGGCAATGATTGCTAAAAGGGACAATGTCTGTGTATGTGAATAGTACCAGCCTGTGTACAAGTCCCTCATTCCCATATCCTGAGTCTCAGCCTGGGACGAACACTGGGCAGAAGGCACATTTTCCTGGGAAGATCTGAACTGGCAGCACCCCACCTTTCCTCTGTCCTCCATCCTTCTCCCAGGGCAGTAAAAGGGGACCTGGATACATGATGATCCCCACCCTGGGACCCTGAATCATGACTT
>XM_005588877.2
cgatcctacctcagtagctggaaccacagGATTCAGCACCATGGCGGAAGAAGACATTGAGACCAAAATCAAGAACTACAAGACTGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACCAGGAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGCCAGAAGGCAATGACCACTAAAGGAGGCAATGTCTCTGTGTGCGAATGGTACCAGCGTGTGTACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGACGAGCAACGGGCTGAAGGCACGTTTCCCGGGAAGATCTGAACTGGCTGTACCTCCCTGTCCTCTGTCCTCTGTCCTTCTCCCAGGATGGTGAAGGGGGACCTAGTACCTAGTGATCCCCACCCCGGGATCCTAAATCGTGACTTACCTGCTAATAAAAACTCGTTGGAAAAGTGA

Publications

PMID - Link Title
No publications available for this retrocopy