| Retrocopy Name | PAGE4P1 |
|
| Species | Macaca fascicularis | |
| Coordinates | chr3:58308782-58308994 UCSC | |
| Strand | + | |
| Parental Sequence | XM_005593568.2 | |
| Parental seq. overlap | 177 bp | |
| Parental seq. overlap (%) | 25.9% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | PAGE4P1, located on chr3:58308782-58308994, is a retrocopy of the parental gene PAGE4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | PAGE4 |
| Full Name | N/A |
| Also known as | - |
| Coordinate | chrX:48068857-48148085 |
| Strand | + |
| Gene summary | N/A |
| Species | Scientific Name | Retrocopy | |
![]() |
Rhesus | Macaca mulatta | PAGE4P1 |
![]() |
Baboon | Papio anubis | PAGE4P2 |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >PAGE4P1 |
| TAGGATATTGAACTTGGACAAGAGAGAGAATACAATATACACCTGTGATTGAGCAACATAAATTAGAAGGTGATTGCCAGAAATTTGGTCTGGAAAAGACTGGGAGTGAGTGCAAAGATGGCCCTGATGTAAAAGGGAAGACTCCACCTAATCTGAAGCATGCTAAGATTACAGAAGCAGGAGATGGACAGCCATAAGTTAAAAAGAAGACAA |
| >XM_005593568.2 |
| TTCACAACCTCCGTTCCATAGACAGTTGCTTACCCCACCCCTTGTCACTGGAATAAAATCATTTGAAATATCTAACACCTAAAATTGCTAAAATGCACAGTGGACCTACGTAACAGCGATTTATGCCTATGAGGGCCTGCAGCCAAAATGAACAAGGAGAGAGCTGGGCTGCTGTCAGTGTTATTGTGGCTCATTGTCTATGTACCAACTGCAGTGCTACAGAGGCAGTCTTCAGTTCACGATCTTCTAGTTGGAGCGATGAGTGCACGAGTGAGATCAAGATCCAGAGGAAGAGGAGATGGTCAGGAGGCTCCCGATGTGTTTGCATTCGTGGCTCCCGGTGAATCTCAGCAAGAGGAACCACCAACTGACAATCAGGATATTGAACCTGGACGAGAGAGAGAAAGAACACCTCCGATTGAAGAACGTAAAGTGGAAGGTGATTGCCAGGAAATGGATCTGGAAAACACTGGGAATGAGCGTGGAGACGGCTCTGATGTAAAAGAGAAGACTCCACCTAATCCGGAGCGTGCTAAGACTAAAGAAGCAGGAGATGGGCAACCATAAGTTAAAAAGAAGACAAGCTGAAGCTACACACATGGCTGATGTCACATTGAAAATGTGACTGAAAATTTGAAAAttctctcaataaagtttgaattttctctgaagaagtca |
| PMID - Link | Title |
|---|