Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPL37P14
Plot displaying the genomic locations of a retrocopy (in chr6) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Macaca fascicularis
Coordinates chr6:53844351-53844503  UCSC
Strand +
Parental Sequence XM_005595986.2
Parental seq. overlap 131 bp
Parental seq. overlap (%) 20.9%
Genomic Region Intergenic
Retrocopy Summary RPL37P14, located on chr6:53844351-53844503, is a retrocopy of the parental gene RPL37. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL37
Full Name N/A
Also known as -
Coordinate chr6:41312381-41315077
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens RPL37P25
Chimpanzee Pan troglodytes RPL37P8
Bonobo Pan paniscus RPL37P8
Gibbon Nomascus leucogenys RPL37P7
Green monkey Chlorocebus sabaeus RPL37P6
Rhesus Macaca mulatta LOC114674108P4
Baboon Papio anubis RPL37P11
Golden snub-nosed monkey Rhinopithecus roxellana RPL37P4
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL37P14
TGCCGCTGTGGCGCTAAGGCCTACCAACTTCAGAGGTTGATCTGTGTCAAATGCAGCCACCCTGACAAGCACAAGAGAAAGTATAACTAGAGTACCAAGGCTGAAAGAGGAAATGCCACCAGGACTGGTCAAATGAGGCACTTAAAAATTGTA
>XM_005595986.2
CGGCACGAAAAGCCGCTCACGGTCCAAGCGGGGGAGGCGAACACTCGGCCAACCGGTCGCCAGCCAACTGGGAGTCCCACCCACCTTTCCGGCACTGAAGACGCGATTGGCCGCGCCTGGTACCGCATCCTCCTCTTGACCCCACCGACACTACGGCGACGGACGCTTGGGAACGTTGCACAGCCCTCCGCAGGAAGTACTTCCCTGGGCGGAAGCTTCTGAGCGTGATATAGCGGAAGTGCCTTCTCTTCCGGTCTCTCTGGTCTCGGCTGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACACATTGTGCCGCCGCTGTGGCTCTAAGGCCTACCACCTTCAGAAGTCGACCTGTGGCAAATGTGGCTACCCTGCCAAGCGCAAGAGAAAGTATAACTGGAGTGCTAAGGCTAAAAGACGAAATACCACCGGAACTGGTCGAATGAGGCACCTAAAAATTGTATACCGCAGATTCAGGCATGGATTCCGTGAAGGAACAACACCTAAACCCAAGAGGGCAGCTGTTGCAGCATCTAGTTCATCTTAAGAATGTCAACGATTAGTCATGCAATAAATGCTCTGGTTTTTAAAAATACA

Publications

PMID - Link Title