Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name HMGN1P22
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr4). Each line represents a retrocopy.
Species Papio anubis
Coordinates chr8:112083487-112083718  UCSC
Strand +
Parental Sequence NM_001168994.1
Parental seq. overlap 208 bp
Parental seq. overlap (%) 67.8%
Genomic Region Intragenic (EIF3H)
Retrocopy Summary HMGN1P22, located on chr8:112083487-112083718, is a retrocopy of the parental gene HMGN1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name HMGN1
Full Name N/A
Also known as -
Coordinate chr4:174874188-174880416
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens HMGN1P40
Chimpanzee Pan troglodytes HMGN1P16
Bonobo Pan paniscus HMGN1P15
Gorilla Gorilla gorilla HMGN1P16
Orangutan Pongo abelii HMGN1P16
Gibbon Nomascus leucogenys HMGN1P28
Green monkey Chlorocebus sabaeus HMGN1P10
Crab-eating macaque Macaca fascicularis HMGN1P24
Rhesus Macaca mulatta HMGN1P24
Golden snub-nosed monkey Rhinopithecus roxellana HMGN1P25
Marmoset Callithrix jacchus HMGN1P23
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>HMGN1P22
TGCGGTTGTCAGCTAAACTTGCTCCCGCAAAAGTGGAAACAAAGCTAAAAAAGGCAGCAGGAAAGGATAAATCTTCAGACAAAAAAGTGCAAACAAAGGGAAAAGGGGAGCAAAGGGAAAACAGGCCAAAGTGGCCAACCAGGAAACTAAAGAAATTTACCTGCACAAAACGAAGAAACCAAAACTGAGAAAAGTCCAGCCTCTGATGACACCAGAGATAAAGAAGCCAAGT
>NM_001168994.1
ATGCCCAAGAGGAAGGTCAGCTCCGCCGAAGGGGCCGCCAAGGAAGAGcCCAAGAGGAGATCGGCGCGGTTGTCAGCTAAACCTCCTGCCAAAGTGGAAGCGAAGCCGAAAAAGGCAGCAGCGAAGGATAAATCTTCAGACAAAAAAGtgcaaacaaaagggaaaaggggagcaAAGGGAAAACAGGCCGAAGTGGCTAACCAAGAAACTAAAGAAGATTTACCTGCAGAAAACGGGGAAACGAAAACTGAGGAGaGTCCAGCCTCTgatgaagcaggagagaaagaagccaagTCTGATTAA

Publications

PMID - Link Title