Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL37P2
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr5). Each line represents a retrocopy.
Species Papio anubis
Coordinates chr1:52314049-52314354  UCSC
Strand +
Parental Sequence XM_003899614.3
Parental seq. overlap 213 bp
Parental seq. overlap (%) 45.1%
Genomic Region Intergenic
Retrocopy Summary RPL37P2, located on chr1:52314049-52314354, is a retrocopy of the parental gene RPL37. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL37
Full Name N/A
Also known as -
Coordinate chr5:39640756-39643278
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens RPL37P27
Chimpanzee Pan troglodytes RPL37P2
Bonobo Pan paniscus RPL37P2
Gorilla Gorilla gorilla RPL37P3
Orangutan Pongo abelii RPL37P1
Green monkey Chlorocebus sabaeus RPL37P19
Rhesus Macaca mulatta RPL37P2
Golden snub-nosed monkey Rhinopithecus roxellana RPL37P17
Marmoset Callithrix jacchus RPL37P20
Gibbon Nomascus leucogenys Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL37P2
ACAGAAGCGAGACAAAGGGAACATCGTCGTTTGGAAAGCATTGCAATAAGACACACACGTTGTGCTGCCGCTGTGCCTCTAAGACCTACCACCTTCAGAAGTCAACCCGTGGCAAATGTGGCTACGCTGCCAAGCACAAGAGGAAGTAAAACTGGAGTGCCAGTGCTGAAAGATGAAACACCACCAGGGCTAGTCAAATAAGGCACCTAAAAAGTGTGTATCACAGATTCAGGTATGGATCCCGTGAA
>XM_003899614.3
GGCGACGGACGCTTGGGAACGCTGCACAGCGCTCCGCAGGAAGTACTTCCCTGGGCGGAAGCTTCTGAGCGTGATATAGCGGAAGTGCCTTCTCTTCCGGTCTCTCTGGTCTCGGCTGCAGAAGCGAGATGACGAAGGGAACGTCATCATTTGGAAAGCGTCGCAATAAGACGCACACATTGTGCCGCCGCTGTGGCTCTAAGGCCTACCACCTTCAGAAGTCGACCTGTGGCAAATGTGGCTACCCTGCCAAGCGCAAGAGAAAGTATAACTGGAGTGCCAAGGCTAAAAGACGAAATACCACCGGAACTGGTCGAATGAGGCACCTAAAAATTGTATACCGCAGATTCAGGCATGGATTCCGTGAAGGAACAACACCTAAACCCAAGAGGGCAGCTGTTGCAGCATCTAGTTCATCTTAAGAATGTCAACGATTAGTCATGCAATAAAtgttctggttttaaaaaataca

Publications

PMID - Link Title