Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name LOC104656765P2
Plot displaying the genomic locations of a retrocopy (in chr17) and its respective parental gene (in chr15). Each line represents a retrocopy.
Species Rhinopithecus roxellana
Coordinates chr17:40902826-40903046  UCSC
Strand +
Parental Sequence XM_010356490.2
Parental seq. overlap 191 bp
Parental seq. overlap (%) 55.5%
Genomic Region Intergenic
Retrocopy Summary LOC104656765P2, located on chr17:40902826-40903046, is a retrocopy of the parental gene LOC104656765. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name LOC104656765
Full Name N/A
Also known as LOC104656765
Coordinate chr15:14212313-14213220
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens IFITM3P9
Chimpanzee Pan troglodytes IFITM3P2
Bonobo Pan paniscus LOC100971164P2
Gorilla Gorilla gorilla LOC101128980P3
Orangutan Pongo abelii LOC100455435P1
Gibbon Nomascus leucogenys LOC100594097P5
Green monkey Chlorocebus sabaeus IFITM1P5
Crab-eating macaque Macaca fascicularis LOC102145938P10
Rhesus Macaca mulatta LOC697829P8
Baboon Papio anubis LOC101000441P3
Marmoset Callithrix jacchus LOC118145580P2
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>LOC104656765P2
TCCCTCTTCATGAACTGGTGCTACGGGGGCTTCATAGCATTCACCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACCTGAGCGGGGCCCAGGCCTATGCCTCCACTGCCAAGCGCCTGAACATTTGTACCCTTACCCTGGACATCCATGTGACCACAGCACTCATCATCCTTTTCACCAGTAGCTCTATGATAATATTCCAAGCAATTTCTCA
>XM_010356490.2
ACATCAGCTTCCCGGAAACCTGAGACATGATCAAGGAGGAGCACTGTGTGAAGTCAGCCATGACCCACATCCGCAGCGAGACCTCCGCGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCATGAACCCCTGCTGCCTGGGCTTCATAGCATTCGCCTCCTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACCTGACTGGAGCCCAGGCCTGTGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGACTGTGGGCATCTTTGTGACGACTGCACTCACCATCCTTTCACCAGTAGTTCTGTGATAATATTCCAAGCAATTTCTCAGATG

Publications

PMID - Link Title