Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL34P22
Plot displaying the genomic locations of a retrocopy (in chr11) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Rhinopithecus roxellana
Coordinates chr11:75999991-76000157  UCSC
Strand +
Parental Sequence XM_010379088.2
Parental seq. overlap 149 bp
Parental seq. overlap (%) 31.8%
Genomic Region Intragenic (RRP12)
Retrocopy Summary RPL34P22, located on chr11:75999991-76000157, is a retrocopy of the parental gene RPL34. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL34
Full Name N/A
Also known as RPL34
Coordinate chr2:20962101-20966662
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens RPL34P20
Chimpanzee Pan troglodytes RPL34P22
Bonobo Pan paniscus RPL34P19
Gorilla Gorilla gorilla RPL34P22
Orangutan Pongo abelii RPL34P23
Gibbon Nomascus leucogenys RPL34P7
Green monkey Chlorocebus sabaeus RPL34P14
Crab-eating macaque Macaca fascicularis RPL34P25
Rhesus Macaca mulatta RPL34P23
Baboon Papio anubis RPL34P24
Marmoset Callithrix jacchus RPL34P32
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL34P22
ACCTCTAACAAAACTAGGCTGTCCTGAACCCCTGGTAATAGAATCATTTACCTTTATGCCAAGAAGGTTGGGAAAGCACCAGAATCTTCACGTGGTGTGTGCCCAGGCAGATGTTCAGGAGCTCATGTTGTGAGATCTAAAGTTCTTATTTGATTGTCCAAAACAAA
>XM_010379088.2
TTTGACCTTTGAACTCGCAAaagcttttttcttcctcttccggGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACGTAGGCTTTCCTACAATACAGCCTCTAACAAAACTAGGCTGTCCCGAACCCCTGGTAATAGAATTGTTTACCTTTATACCAAGAAGGTTGGGAAAGCACCAAAATCTGCATGTGGTGTGTGCCCAGGCAGACTTCGAGGGGTTCGTGCTGTAAGACCTAAAGTTCTTATGAGATTgtccaaaacaaagaaacatgtcAGCAGGGCCTATGGTGGTTCCATGTGTGCTAAATGTGTTCGTGACAGGATCAAGCGTGCTTTCCTTATCGAGGAGCAGAAAATCGTTGTGAAAGTGTTGAAGGCACAAGCACAGAGTCAGAAAgctaaataaaaaaatgaaacttttttgagtaataaaaatgaaaagacttgctgta

Publications

PMID - Link Title