Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFA4P15
Plot displaying the genomic locations of a retrocopy (in chr10) and its respective parental gene (in chr8). Each line represents a retrocopy.
Species Callithrix jacchus
Coordinates chr10:133458993-133459136  UCSC
Strand -
Parental Sequence NM_001253776.1
Parental seq. overlap 122 bp
Parental seq. overlap (%) 48.6%
Genomic Region Intragenic (DYNC1H1)
Retrocopy Summary NDUFA4P15, located on chr10:133458993-133459136, is a retrocopy of the parental gene NDUFA4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFA4
Full Name N/A
Also known as -
Coordinate chr8:45757810-45764674
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens NDUFA4P21
Chimpanzee Pan troglodytes NDUFA4P21
Bonobo Pan paniscus NDUFA4P21
Gorilla Gorilla gorilla NDUFA4P20
Orangutan Pongo abelii NDUFA4P18
Gibbon Nomascus leucogenys NDUFA4P15
Green monkey Chlorocebus sabaeus NDUFA4P16
Crab-eating macaque Macaca fascicularis NDUFA4P10
Rhesus Macaca mulatta NDUFA4P9
Baboon Papio anubis NDUFA4P8
Golden snub-nosed monkey Rhinopithecus roxellana NDUFA4P5
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFA4P15
TGGCATTGTTCAATCCAGATCTTGCTTGGGACTGAAAGAATAACTGAGAGCCCTAGAACAGACGAGGTCACAGGGATCGATACAAGTTCTATTCAGTGAATGTGGATTACAGTACATGTAAGAAAGAATGGCCAGATTTCTAAA
>NM_001253776.1
ATGCTCCGCCACATCTTAGGTCAGGCCAAGAAGCATCCGAGCTTGATCCCCCTGTTTGTATTTATTGGAGCTGGAGGTGGTGGAGCAGCCCTGTATCTCTTGCGTTTGGCATTGTTCAATCCAGATGTTTGttgGGACAAAAAGAATAACCCAGAGCCCTGGAACAAACTGGGTCCCAATGATCAATACAAGtTCTACTCAGTGAATGTGGATTACAGCAAACTGAAGAAAGAACGTCCAGATTTCTAA

Publications

PMID - Link Title