| Retrocopy Name | Dynll1P9 | 
                 | 
        
| Species | Rattus norvegicus | |
| Coordinates | chr14:78800194-78800365 UCSC | |
| Strand | + | |
| Parental Sequence | NM_053319.3 | |
| Parental seq. overlap | 142 bp | |
| Parental seq. overlap (%) | 21.7% | |
| Genomic Region | 
									Intergenic | 
        |
| Retrocopy Summary | Dynll1P9, located on chr14:78800194-78800365, is a retrocopy of the parental gene Dynll1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. | 
| Gene Name | Dynll1 | 
| Full Name | dynein light chain LC8-type 1 | 
| Also known as | 8kDLC|Dlc8|Dnclc1|Pin | 
| Coordinate | chr12:47074200-47076573 | 
| Strand | + | 
| Gene summary | Enables several functions, including identical protein binding activity; nitric-oxide synthase regulator activity; and scaffold protein binding activity. Involved in positive regulation of insulin secretion involved in cellular response to glucose stimulus and spermatid development. Acts upstream of or within negative regulation of nitric oxide biosynthetic process. Located in axon cytoplasm; nucleus; and secretory granule. Part of cytoplasmic dynein complex. Colocalizes with mitochondrion. Used to study hypertension and impotence. Biomarker of cardiac arrest; congestive heart failure; and middle cerebral artery infarction. Orthologous to human DYNLL1 (dynein light chain LC8-type 1). [provided by Alliance of Genome Resources, Apr 2022] | 
| Species | Scientific Name | Retrocopy | |
![]()  | 
			Human | Homo sapiens | Without Homology | 
![]()  | 
			Chimpanzee | Pan troglodytes | Without Homology | 
![]()  | 
			Bonobo | Pan paniscus | Without Homology | 
![]()  | 
			Gorilla | Gorilla gorilla | Without Homology | 
![]()  | 
			Orangutan | Pongo abelii | Without Homology | 
![]()  | 
			Gibbon | Nomascus leucogenys | Without Homology | 
![]()  | 
			Green monkey | Chlorocebus sabaeus | Without Homology | 
![]()  | 
			Crab-eating macaque | Macaca fascicularis | Without Homology | 
![]()  | 
			Rhesus | Macaca mulatta | Without Homology | 
![]()  | 
			Baboon | Papio anubis | Without Homology | 
![]()  | 
			Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology | 
![]()  | 
			Marmoset | Callithrix jacchus | Without Homology | 
![]()  | 
			Mouse lemur | Microcebus murinus | Without Homology | 
![]()  | 
			Mouse | Mus musculus | Without Homology | 
![]()  | 
			Chinese hamster | Cricetulus griseus | Without Homology | 
![]()  | 
			Rabbit | Oryctolagus cuniculus | Without Homology | 
![]()  | 
			Pig | Sus scrofa | Without Homology | 
![]()  | 
			Cow | Bos taurus | Without Homology | 
![]()  | 
			Sheep | Ovis aries | Without Homology | 
![]()  | 
			Dolphin | Tursiops truncatus | Without Homology | 
![]()  | 
			Horse | Equus caballus | Without Homology | 
![]()  | 
			Dog | Canis familiaris | Without Homology | 
![]()  | 
			Panda | Ailuropoda melanoleuca | Without Homology | 
![]()  | 
			Cat | Felis catus | Without Homology | 
![]()  | 
			Pale spear-nosed bat | Phyllostomus discolor | Without Homology | 
![]()  | 
			Velvety free-tailed bat | Molossus molossus | Without Homology | 
![]()  | 
			Greater mouse-eared bat | Myotis myotis | Without Homology | 
![]()  | 
			Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology | 
![]()  | 
			Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology | 
![]()  | 
			Egyptian rousette | Rousettus aegyptiacus | Without Homology | 
![]()  | 
			Sloth | Choloepus didactylus | Without Homology | 
![]()  | 
			Tasmanian Devil | Sarcophilus harrisii | Without Homology | 
![]()  | 
			Opossum | Monodelphis domestica | Without Homology | 
![]()  | 
			Platypus | Ornithorhynchus anatinus | Without Homology | 
![]()  | 
			Chicken | Gallus gallus | Without Homology | 
![]()  | 
			Turkey | Meleagris gallopavo | Without Homology | 
![]()  | 
			Zebra Finch | Taeniopygia guttata | Without Homology | 
![]()  | 
			Budgerigar | Melopsittacus undulatus | Without Homology | 
![]()  | 
			Painted Turtle | Chrysemys picta | Without Homology | 
![]()  | 
			Lizard | Anolis Carolinensis | Without Homology | 
![]()  | 
			Frog | Xenopus tropicalis | Without Homology | 
![]()  | 
			Zebrafish | Danio rerio | Without Homology | 
![]()  | 
			Drosophila | Drosophila melanogaster | Without Homology | 
| >Dynll1P9 | 
| TCTGCTGCTTGAGCAGCACCAGCACCTTCCCCAGGAGTTCCCTGGAGCCTACTGGCCCCTGCTCCATGGTAATCGTGTGCAACTGGAAGGCGGTGATCAGAAATGCAGACTTGTCAGAAGACAGGACACAAGATTCAGTGGAGCGCAAGACTCAGGTGTTGGAGAAGTACAA | 
| >NM_053319.3 | 
| AGATGCGCCACGGCTTCGGTAGCGACCGGCTGTCCACTGCTGCTTGAGCGGCGCCAGCACCTTCCCTAGGAGCTCGCAGCAGCCGGCTGGCCCCTGCTCCACGGTAACCATGTGCGACCGGAAGGCGGTGATCAAAAATGCAGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTACTCAGGCGTTGGAGAAGTACAACATAGAGAAGGATATCGCGGCCCATATCAAGAAGGAGTTTGACAAGAAGTACAACCCCACCTGGCACTGCATCGTGGGCCGGAACTTCGGTAGCTACGTGACACACGAGACCAAACACTTCATCTACTTCTACCTGGGTCAGGTGGCCATTCTCCTGTTCAAATCTGGTTAATAGCATGGACTGTGCCAAACACCCAGTGATCCATCCAAAAACAAGGACTGCATCCTAAATTCCAAATACCAGAGACTGAATCTTCAGCCTTGCTAAGGGAACACCTCGTTTGAATCTGTTGTGTTTTGTACAGGGCACCATTCTCTGTACACGTTTGTGGTTATAAAATTAGTAAAACAGCTTACATTTGTATTTATTTTCTAGTCCATACTTCTGTACCCCCATTTTTTTCTCCCTTAGGTCATTCCTTTAAAATAAATCTGTTGGAGATGTA | 
| PMID - Link | Title | 
|---|