| Retrocopy Name | Rps27aP4 |
|
| Species | Rattus norvegicus | |
| Coordinates | chr2:11071963-11072270 UCSC | |
| Strand | - | |
| Parental Sequence | NM_001305443.1 | |
| Parental seq. overlap | 273 bp | |
| Parental seq. overlap (%) | 26.3% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | Rps27aP4, located on chr2:11071963-11072270, is a retrocopy of the parental gene Rps27a. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | Rps27a |
| Full Name | ribosomal protein S27a |
| Also known as | - |
| Coordinate | chr14:113966163-113968440 |
| Strand | - |
| Gene summary | The protein encoded by this gene is a fusion protein that contains ubiquitin at its N-terminus and ribosomal protein S27a at its C-terminus. When the human ortholog of this protein is expressed in yeast, it is processed post-translationally into two products, a free ubiquitin monomer and ribosomal protein S27a, a component of the 40S ribosomal subunit. There are multiple pseudogenes of this gene. There is a locus on chromosome 5 (GeneID:81777) that contains an intact copy of the open reading frame of this gene, that is likely to be the result of retrotransposition of an mRNA into the genome. The transcriptional status of this locus cannot be verified at the present time. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015] |
| Species | Scientific Name | Retrocopy | |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >Rps27aP4 |
| GCCATGATGCAGATTTTTGTGAAGACCCTTACGGGGAAGACCATCACGCTCAAGTTTGAAACCCTCGGACACTATAGAAAATGTAAAGACCAAGATCCAGGATAAGGAAGGAACTCCTCCCGATCAGCAGAGGTTAATCTTTGCTGGTAAGCAGCTAGAAAAATGGCCATACTTTGTCTTGCTACAACTTTCAAAAGAAGTCTACCCTTCATCTTATGTTGAGACTTTCTGGTGGTGTTAAGAAAAGGAAGAAGTCTACACCACTCCCAAGAAGAATAAGCATGAGAGGAAGAAGGTTAAGTTGGCTC |
| >NM_001305443.1 |
| GTTGGTGAGTGTGTGCTCTGTGGCCCGGCTCTGGCTAGTGGCTCTACCGGTCGCTCTCACTGGTGTGGTCGGGTCTAATCCGTCTCTTTTCGAATGCAGGTGGAGCAGCCGCCACGATGCAGATTTTTGTGAAGACCCTTACAGGGAAGACCATCACGCTCGAGGTTGAACCCTCGGACACTATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGGTTGATCTTTGCTGGTAAGCAGTTGGAAGATGGCCGTACTTTGTCTGACTACAACATTCAAAAGGAGTCCACTCTCCATCTCGTGCTGAGACTTCGTGGTGGCGCTAAGAAAAGGAAGAAGAAGTCTTACACCACCCCAAAGAAGAACAAGCATAAGAGAAAGAAGGTCAAGTTGGCTGTGCTGAAATACTATAAGGTGGATGAAAATGGCAAAATCAGCCGACTTCGTCGGGAATGTCCTTCTGATGAATGTGGTGCTGGAGTTTTCATGGGTAGCCACTTTGACAGGCATTACTGTGGCAAGTGTTGTCTGACTTACTGCTTCAACAAACCAGAAGACAAGTAGTTGTGTATGAGTTAATAAAGAGAAGGAACTGATGTTTAGTATTGTGTTTTATTATTGTTTAAGCAATGTTTCTTCAGCTGTGTAACAGTCCTTGGTCAGGAGAGTTTGATCGTAATGGTAAGCCATCTTGGCTTTGGCTTTCCTGGCAGGCACAAAGGTCAGAATTCTTTAAGGGGTTGTGGGATATCCTGTAGACTTGGAAGTAGTGTGATCTTGTCTTACGAGACATGAGAGTAGTCTCACAGTACATTCAAGATGCTTCCTGAGGTTGGCTATGTGTGTGAGCTGTTAAATATTTTCAGTGTTGATGGTGATTTTTCCTCTATAAGAGGTAagctaggcatgtggtgcatagttaaggtttcagcacttgggagacttcagcaggagatttgctgccagcttgtgccagcaagacactgtatttaaataaagaaaCGAAAACAAA |
| PMID - Link | Title |
|---|