Warning (2): rename(/var/www/logs/error.log,/var/www/logs/error.log.1790111700): No such file or directory [CORE/src/Log/Engine/FileLog.php, line 206]
RCPedia: Rtcs

Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name Rps27aP6
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Rattus norvegicus
Coordinates chr2:58001969-58002142  UCSC
Strand -
Parental Sequence NM_001305443.1
Parental seq. overlap 150 bp
Parental seq. overlap (%) 14.5%
Genomic Region Intergenic
Retrocopy Summary Rps27aP6, located on chr2:58001969-58002142, is a retrocopy of the parental gene Rps27a. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Rps27a
Full Name ribosomal protein S27a
Also known as -
Coordinate chr14:113966163-113968440
Strand -
Gene summary The protein encoded by this gene is a fusion protein that contains ubiquitin at its N-terminus and ribosomal protein S27a at its C-terminus. When the human ortholog of this protein is expressed in yeast, it is processed post-translationally into two products, a free ubiquitin monomer and ribosomal protein S27a, a component of the 40S ribosomal subunit. There are multiple pseudogenes of this gene. There is a locus on chromosome 5 (GeneID:81777) that contains an intact copy of the open reading frame of this gene, that is likely to be the result of retrotransposition of an mRNA into the genome. The transcriptional status of this locus cannot be verified at the present time. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Rps27aP6
CACTATGGAAAATGTAAAGGCCAAGATCTGGCACAAGGAAGGATTTCCTCCTGATCAGCAGAGGCCGATCTTTGCTGGTAAGCAGTTGGAAGGTGGCCACACACTGTCTGAAAACAGCATTCAAAAGGAGTCTACCTCACCTGGTGTTGAGACTTCACGGTGGTGCTAAGAAAG
>NM_001305443.1
GTTGGTGAGTGTGTGCTCTGTGGCCCGGCTCTGGCTAGTGGCTCTACCGGTCGCTCTCACTGGTGTGGTCGGGTCTAATCCGTCTCTTTTCGAATGCAGGTGGAGCAGCCGCCACGATGCAGATTTTTGTGAAGACCCTTACAGGGAAGACCATCACGCTCGAGGTTGAACCCTCGGACACTATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGGTTGATCTTTGCTGGTAAGCAGTTGGAAGATGGCCGTACTTTGTCTGACTACAACATTCAAAAGGAGTCCACTCTCCATCTCGTGCTGAGACTTCGTGGTGGCGCTAAGAAAAGGAAGAAGAAGTCTTACACCACCCCAAAGAAGAACAAGCATAAGAGAAAGAAGGTCAAGTTGGCTGTGCTGAAATACTATAAGGTGGATGAAAATGGCAAAATCAGCCGACTTCGTCGGGAATGTCCTTCTGATGAATGTGGTGCTGGAGTTTTCATGGGTAGCCACTTTGACAGGCATTACTGTGGCAAGTGTTGTCTGACTTACTGCTTCAACAAACCAGAAGACAAGTAGTTGTGTATGAGTTAATAAAGAGAAGGAACTGATGTTTAGTATTGTGTTTTATTATTGTTTAAGCAATGTTTCTTCAGCTGTGTAACAGTCCTTGGTCAGGAGAGTTTGATCGTAATGGTAAGCCATCTTGGCTTTGGCTTTCCTGGCAGGCACAAAGGTCAGAATTCTTTAAGGGGTTGTGGGATATCCTGTAGACTTGGAAGTAGTGTGATCTTGTCTTACGAGACATGAGAGTAGTCTCACAGTACATTCAAGATGCTTCCTGAGGTTGGCTATGTGTGTGAGCTGTTAAATATTTTCAGTGTTGATGGTGATTTTTCCTCTATAAGAGGTAagctaggcatgtggtgcatagttaaggtttcagcacttgggagacttcagcaggagatttgctgccagcttgtgccagcaagacactgtatttaaataaagaaaCGAAAACAAA

Publications

PMID - Link Title