Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS27LP4
Wait
Plot displaying the genomic locations of a retrocopy (in chr16) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Tursiops truncatus
Coordinates chr16:6638624-6638771  UCSC
Strand +
Parental Sequence XM_004316253.3
Parental seq. overlap 122 bp
Parental seq. overlap (%) 22.8%
Genomic Region Intergenic
Retrocopy Summary RPS27LP4, located on chr16:6638624-6638771, is a retrocopy of the parental gene RPS27L. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS27L
Full Name N/A
Also known as -
Coordinate chr2:105299051-105302548
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens RPS27P18
Chimpanzee Pan troglodytes RPS27LP2
Bonobo Pan paniscus RPS27LP2
Gorilla Gorilla gorilla RPS27LP2
Orangutan Pongo abelii RPS27LP2
Gibbon Nomascus leucogenys RPS27LP3
Green monkey Chlorocebus sabaeus RPS27LP3
Crab-eating macaque Macaca fascicularis RPS27LP2
Rhesus Macaca mulatta RPS27LP2
Baboon Papio anubis RPS27LP2
Golden snub-nosed monkey Rhinopithecus roxellana RPS27LP1
Marmoset Callithrix jacchus RPS27LP3
Sheep Ovis aries RPS27LP4
Horse Equus caballus RPS27LP1
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS27LP4
GGTGCCGGCTGACAGAAGGAAAAGCCAGGCTCAAGGAAGGATATTCACTTAGAAGCAACACGAGTCATCCACACACCTTCCTGACTGCGTTCTGTTGCAGAAAGCTTCATCAGTTCAGTAATTCTAGTTAATCTAACCAGATAGTGTA
>XM_004316253.3
ctcccagcctcctctaTCCCGGAAGTTGACGCCGCGCTCCCGGTCGCGTGCTGCTTGCTTGGGGTGTCGCCTTAGAGATCTGCACGGGCTGGGCTTGCGAAAGGATCAACATGCCTTTGGCTAGAGATTTACTGCATCCTTCcttggaagaggaaaagaaaaaacataaaaagaaacggcTGGTTCAAAGtccaaattcttattttatggatGTAAAATGTCCAGGCTGCTACAAGATTACCACGGTTTTCAGCCATGCTCAGACAGTGGTGCTTTGTGTAGGTTGTTCAACCGTGTTGTGCCAGCCGACAGGAGGAAAGGCCAGACTCACAGAAGGGTGTTCATTTAGAAGAAAGCAACACTAATGATCCACACAACTTCCTGAATTTGTGTTCTATCACAGAAAGCCTTATCAGTTCAGTAATTCCAGTTAATCTACCAAGATAAtgtaattatgtttaattttgtaaggtaTACAACAGTGCTCTCCTATTTTGCTGTCagtttttcaataaagttttgaTTATGGgcaaa

Publications

PMID - Link Title
No publications available for this retrocopy