Retrocopy Name | OAZ1P1 |
|
Species | Chrysemys picta | |
Coordinates | chr3:70579758-70580072 UCSC | |
Strand | - | |
Parental Sequence | NM_001289869.1 | |
Parental seq. overlap | 297 bp | |
Parental seq. overlap (%) | 28.6% | |
Genomic Region |
Intragenic (BIRC6) |
|
Retrocopy Summary | OAZ1P1, located on chr3:70579758-70580072, is a retrocopy of the parental gene OAZ1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | OAZ1 |
Full Name | N/A |
Also known as | - |
Coordinate | NW_024885822:4272240-4277581 |
Strand | + |
Gene summary | The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamine in cells. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis pathway; thus, completing the auto-regulatory circuit. This gene encodes antizyme 1, the first member of the antizyme family, that has broad tissue distribution, and negatively regulates intracellular polyamine levels by binding to and targeting ODC for degradation, as well as by inhibiting polyamine uptake. Antizyme 1 mRNA contains two potential in-frame AUGs, and studies in rat suggest that alternative use of the two translation initiation sites results in N-terminally distinct protein isoforms with different subcellular localization (PMID:16120325). [provided by RefSeq, Jul 2014] |
Species | Scientific Name | Retrocopy | |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>OAZ1P1 |
TCAAGGCTTACAGAGGCCAAACATGTTAATTGGAGGGCAGTGTTGAACAACCACCACCTATATATTGAAATTCCCAGCAGTGCTCTGCCTGAAAGGAGCAAAGACAATTCTGCAGTCCTTCTTGAGTTTGCTGAAGAACAGCTTCAAGTTGATCATGTCTTCATTTGCTTCCACAAGAACAGATGACAGAGCTGCATTGCTCTGTACTTTCAACTTTTTGGGCTTTGAGATTGTGAGACCAGGGCATCCCCTTGTCCCCAAGAGACCAGATGCTTGCTTCATGGCCTATATGTTTGAGAGAGACTCTTCAGAAGC |
>NM_001289869.1 |
GCCATTTTGTACGGCAGAGTCTGGGCCGGGGGGAGGCGGCGGAGGGTTTCGGGGTTCGGACCAGAGCGGCCGGATGGTGAAATCCTCCCTGCAGCGGATACTCAACAGTCACTGCTTCgccagagagaaagaggggaatAAAAGCACCATCATCATCATGCCCGCCGTGCTGAGCCTCAGTGCCGGACAGAGCAGTTCCAGGGTTTCTTTCAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCCTGATGTCCCTCACCCACCCCTGAAGATCCCAGGTGGGCGAGGGAATAGTCAGAGGGATCACAATCTTTCAgctaatttattttattctGATAATCGGCTGAACGTAACAGAGGAACTAACATCTAATAACAGGACAAGAATTCTCAATGTCCAGTCAAGGCTTACAGATGCCAAACATGTTAGCTGGAGGGCAGTGCTGAACAACAACAACCTGTATATTGAAATTCCCAGCGGTGCTCTGCCTGAAGGGAGCAAAGACAGttttgcagttcttcTTGAGTTTGCTGAAGAACAGCTTCAAGTTGATCATGTCTTCATTTGCTTCCACAAGAACAGAGATGACAGAGctgcattgctCCGTACTTTCAGCTTTTTGGGCTTTGAGATTGTGAGACCAGGGCATCCCCTTGTCCCCAAAAGACCAGATGCTTGCTTCATGGCCTATACGTTTGAGAGAGACTCTTCGGAAGAAGACTAGATTGCAATGTTTGCCTCTTAGAGCTTTCTTGTTGTCTATAAAGATGAAACTGTAGAAATTTTGTCAACATCTATTATACAGTACTTATACTTGTTtgttctttgtacaaaatattgtGACCAACTGCTCTGGTGGTGGGATGTTGAAAATTTCAAACTTCATCTTTTCTGAATTTGTGCGCATGTTGTGATTGTGCAAATAAATGCTCACTCCAAATTAGCAGTATATTTCTTGAAGTTTAATATTGTGTTTGTGATACCGAAGTATTTGCTTTAATTCTAAATAAAaatttatattttacttttta |
PMID - Link | Title |
---|