Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name CIAO2AP1
Plot displaying the genomic locations of a retrocopy (in scaffold_m29_p_16) and its respective parental gene (in scaffold_m29_p_8). Each line represents a retrocopy.
Species Rhinolophus ferrumequinum
Coordinates scaffold_m29_p_16:21401640-21401795  UCSC
Strand +
Parental Sequence CIAO2A_x3
Parental seq. overlap 127 bp
Parental seq. overlap (%) 32%
Genomic Region Intragenic (ZCWPW2)
Retrocopy Summary CIAO2AP1, located on scaffold_m29_p_16:21401640-21401795, is a retrocopy of the parental gene CIAO2A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name CIAO2A
Full Name N/A
Also known as NULL
Coordinate scaffold_m29_p_8:45589477-45604135
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens CIAO2AP1
Chimpanzee Pan troglodytes FAM96AP2
Bonobo Pan paniscus CIAO2AP2
Gorilla Gorilla gorilla CIAO2AP2
Orangutan Pongo abelii FAM96AP2
Gibbon Nomascus leucogenys CIAO2AP1
Green monkey Chlorocebus sabaeus FAM96AP1
Baboon Papio anubis CIAO2AP2
Golden snub-nosed monkey Rhinopithecus roxellana CIAO2AP1
Dolphin Tursiops truncatus CIAO2AP1
Horse Equus caballus FAM96AP1
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>CIAO2AP1
AGGTTATTATCAGGTTCACGTCCCAATATCTATCTAACTGCTGTTCGGCAACTCTAACTGGGCTGTTGCTTAAGAGTAAAACTCGAGGGCAGTTTATCTTTTAAACCTAAGTTGGAAATCTACATTTCTGCAGGAACACACTCAAAAGAAGAAGAC
>CIAO2A_x3
ATGGAGTGGATGTCGGGGCTGCTGTCCTGGATGCTGAGCAGAGTCGTGTGGCTCTCGGGCCTTTTTGAGCGGGGAGCTGCCCGGCAGCCCCGGATCATGGAAGAGAAAGCGCTAGAAGTTTATGATTTGATTCGAACTATCCGGGACCCGGAGAAGCCCAATACTTTAGAAGAACTGGAAGTGGTAACGGAAAGTTGTGTGGAGGTTCAGGAGATAAATGAAGAGGACTATTTGGTTATTATCAGGTTCACGCCAACAGTACCTCATTGCTCTTTGGCAACTCTTATTGGACTATGCTTAAGAGTGAAACTTCAGCGGTGTTTACCATTTAAACATAAGTTGGAAATCTACATTTCTGAAGGAACCCACTCAACAGAGGAAGACAGTAAGTGA

Publications

PMID - Link Title