RCPedia: Rtcs

Summary

Retrocopy Name	HMGN1BP10	Plot displaying the genomic locations of a retrocopy (in scaffold_m29_p_19) and its respective parental gene (in scaffold_m29_p_2). Each line represents a retrocopy.
Species	Rhinolophus ferrumequinum
Coordinates	scaffold_m29_p_19:39209533-39209675 UCSC
Strand	-
Parental Sequence	HMGN1B_x1
Parental seq. overlap	127 bp
Parental seq. overlap (%)	41.5%
Genomic Region	Intergenic
Retrocopy Summary	HMGN1BP10, located on scaffold_m29_p_19:39209533-39209675, is a retrocopy of the parental gene HMGN1B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name	HMGN1B
Full Name	N/A
Also known as	NULL
Coordinate	scaffold_m29_p_2:104523751-104528600
Strand	-
Gene summary	N/A

Homology

Species	Scientific Name	Retrocopy
Dolphin	Tursiops truncatus	HMGN1P17
Cat	Felis catus	HMGN1P4
Human	Homo sapiens	Without Homology
Chimpanzee	Pan troglodytes	Without Homology
Bonobo	Pan paniscus	Without Homology
Gorilla	Gorilla gorilla	Without Homology
Orangutan	Pongo abelii	Without Homology
Gibbon	Nomascus leucogenys	Without Homology
Green monkey	Chlorocebus sabaeus	Without Homology
Crab-eating macaque	Macaca fascicularis	Without Homology
Rhesus	Macaca mulatta	Without Homology
Baboon	Papio anubis	Without Homology
Golden snub-nosed monkey	Rhinopithecus roxellana	Without Homology
Marmoset	Callithrix jacchus	Without Homology
Mouse lemur	Microcebus murinus	Without Homology
Mouse	Mus musculus	Without Homology
Rat	Rattus norvegicus	Without Homology
Chinese hamster	Cricetulus griseus	Without Homology
Rabbit	Oryctolagus cuniculus	Without Homology
Pig	Sus scrofa	Without Homology
Cow	Bos taurus	Without Homology
Sheep	Ovis aries	Without Homology
Horse	Equus caballus	Without Homology
Dog	Canis familiaris	Without Homology
Panda	Ailuropoda melanoleuca	Without Homology
Pale spear-nosed bat	Phyllostomus discolor	Without Homology
Velvety free-tailed bat	Molossus molossus	Without Homology
Greater mouse-eared bat	Myotis myotis	Without Homology
Kuhl's pipistrelle	Pipistrellus kuhlii	Without Homology
Egyptian rousette	Rousettus aegyptiacus	Without Homology
Sloth	Choloepus didactylus	Without Homology
Tasmanian Devil	Sarcophilus harrisii	Without Homology
Opossum	Monodelphis domestica	Without Homology
Platypus	Ornithorhynchus anatinus	Without Homology
Chicken	Gallus gallus	Without Homology
Turkey	Meleagris gallopavo	Without Homology
Zebra Finch	Taeniopygia guttata	Without Homology
Budgerigar	Melopsittacus undulatus	Without Homology
Painted Turtle	Chrysemys picta	Without Homology
Lizard	Anolis Carolinensis	Without Homology
Frog	Xenopus tropicalis	Without Homology
Zebrafish	Danio rerio	Without Homology
Drosophila	Drosophila melanogaster	Without Homology

Expression

Related Sequence

>HMGN1BP10
AAAAGTGAAACAAAAGGGAAGAGGAAAGCGAAGGGAAAACAGACCAAAGTGTCTAACCAGGAAACTAAAGATTAACCTACAGAAAATGGAGAAACTAAAAATGAGGTGAGTCCAGCCTTTGATGAAGCAGGAGAGAAAGAAGG

>HMGN1B_x1
ATGCCCAAGAGGAAGGTCAGCTCCGCCGAGGGGGCAGCGAAGGAGGAGCCCAAGAGGAGGTCGGCGAGGTTGTCAGCTAAACCTCCTCCTGCAAAAGTGGAAACGAAGCCCAAAAAGGCGTCAGGAAAGGAGAAATCTGCAGACAAAAAAGTGCAAACAAAAGGGAAAAGGGGAGCAAAGGGAAAGCAGGCCGAAGTGGCCAACCAAGAAACTAAAGAAGATTTACCTGCAGAAAACGGAGAAACTAAAAATGAGGAGAGTCCAGCCTCTGATGAAGCAGGAGAGAAAGAAGCCAAGTCTGATTAG

>HMGN1B_x1 

ATGCCCAAGAGGAAGGTCAGCTCCGCCGAGGGGGCAGCGAAGGAGGAGCCCAAGAGGAGGTCGGCGAGGTTGTCAGCTAAACCTCCTCCTGCAAAAGTGGAAACGAAGCCCAAAAAGGCGTCAGGAAAGGAGAAATCTGCAGACAAAAAAGTGCAAACAAAAGGGAAAAGGGGAGCAAAGGGAAAGCAGGCCGAAGTGGCCAACCAAGAAACTAAAGAAGATTTACCTGCAGAAAACGGAGAAACTAAAAATGAGGAGAGTCCAGCCTCTGATGAAGCAGGAGAGAAAGAAGCCAAGTCTGATTAG

Publications

PMID - Link	Title