Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NENFP1
Plot displaying the genomic locations of a retrocopy (in scaffold_m29_p_9) and its respective parental gene (in scaffold_m29_p_21). Each line represents a retrocopy.
Species Rhinolophus ferrumequinum
Coordinates scaffold_m29_p_9:33082127-33082437  UCSC
Strand -
Parental Sequence NENF_x2
Parental seq. overlap 257 bp
Parental seq. overlap (%) 49%
Genomic Region Intragenic (ATPAF1)
Retrocopy Summary NENFP1, located on scaffold_m29_p_9:33082127-33082437, is a retrocopy of the parental gene NENF. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NENF
Full Name N/A
Also known as NULL
Coordinate scaffold_m29_p_21:17715851-17726559
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens NENFP1
Chimpanzee Pan troglodytes NENFP1
Bonobo Pan paniscus NENFP1
Gorilla Gorilla gorilla NENFP1
Orangutan Pongo abelii NENFP1
Green monkey Chlorocebus sabaeus NENFP2
Crab-eating macaque Macaca fascicularis NENFP1
Rhesus Macaca mulatta NENFP1
Baboon Papio anubis NENFP1
Golden snub-nosed monkey Rhinopithecus roxellana NENFP2
Marmoset Callithrix jacchus NENFP1
Mouse lemur Microcebus murinus NENFP1
Dolphin Tursiops truncatus NENFP1
Horse Equus caballus NENFP1
Panda Ailuropoda melanoleuca NENFP1
Gibbon Nomascus leucogenys Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dog Canis familiaris Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NENFP1
GTGAAGAGAGTGGTGTTTAATGTCACCTCTGGAAAGGAGTTTATGGAAGAGGGGTCCCCTAGTGCCTTGACCAGCCAGGATTCCAACAGAGAGGTGAGCAAGATTCCTTGGATCTTACCTGTATCACCCGTGACACTACAGGTCTCATGGCCCAGGAGCTGAAGTTCCTGTATAATGCCTTCTCCAAAGTGTACAGAGCCAAATATCACATCGTCTGCTACATAGCCTGAAGAATTCTTAACGATGGCAGTCCCACCTGGACTTTAGGCCTGAAGACCAGCCCCATTTTGACAGAAAGGACAAGTTCTGAT
>NENF_x2
ATGGCAGGCCCCGCGCCGGggcggaggctgtggccgctggccgcgctggccctggtcctggcgctggacccggagctgCCCGCAGTCCAGGCCGGGCAGACGCCGCGCCCCGCCGAGCGAGGCCCCCCAGTGCGGCTCTTCACCGAGGAGGAGCTGGCCCGCTTCGGCGGGGAGGAGGAAGATCAGCCCATCTACATGGCGGTGAAGGGAGTGGTGTTTGATGTCACTTCTGGAAAGGAGTTTTATGGACGAGGAGCCCCCTACAATGCCTTGACCGGGAAGGACTCCACCAGAGGGGTCGCCAAGATGTCCCTGGATCCTGCAGACCTCACCCATGACACTACCGGCCTCACGGCGGAGGAGCTGAAAGCCCTGGATGACGTCTTCACCACAGTGTACAAGGCCAAGTATCCCATCGTCGGCTACACGGCCCGAAGGATTCTCAACGAGGACGGCAGCCCCAACCTGGACTTCAAGCCTGAAGACCAGCCCCATTTTGACATAAAGGACGAGTTCTGA

Publications

PMID - Link Title