Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name H3F3AP4
Plot displaying the genomic locations of a retrocopy (in scaffold_m13_p_2) and its respective parental gene (in scaffold_m13_p_18). Each line represents a retrocopy.
Species Rousettus aegyptiacus
Coordinates scaffold_m13_p_2:25955328-25955577  UCSC
Strand +
Parental Sequence H3F3A_x2
Parental seq. overlap 202 bp
Parental seq. overlap (%) 48.9%
Genomic Region Intragenic (BMPR2)
Retrocopy Summary H3F3AP4, located on scaffold_m13_p_2:25955328-25955577, is a retrocopy of the parental gene H3F3A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name H3F3A
Full Name N/A
Also known as NULL
Coordinate scaffold_m13_p_18:4119307-4126733
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Horse Equus caballus LOC100054462P7
Cat Felis catus H3F3AP11
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>H3F3AP4
AGTTACAGGCCTGGTACTGTGGTAGTCTGTGAAATTAGACGTGATCAGAAGTCAACTGATATTCTGATTTCTAAACATCCCTTTCAGCATTTGTTAAAGAGAAATTACTCAGGAGGTCAAACAGATCTGCACTTCCACAGCACTGCTACTGGTGTTTTGCAAGGGGCAAATGTGGCCTGACTGGCCTTTTTTGAAGATATCAGCCTATATGCTATCCACGCCAAATGTGTACATTGATGTCAAAAGACAT
>H3F3A_x2
ATGGCTCGTACAAAGCAGACTGCCCGCAAATCGACCGGTGGTAAAGCACCGAGGAAGCAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCGCTCCGTGAAATTAGACGTTATCAAAAGTCCACTGAACTTCTGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTCAAAACAGATCTGCGCTTCCAGAGTGCAGCTATTGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACGTGCTTAA

Publications

PMID - Link Title