Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL39P34
Plot displaying the genomic locations of a retrocopy (in chr10) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Macaca mulatta
Coordinates chr10:92492497-92492796  UCSC
Strand +
Parental Sequence NM_001267538.2
Parental seq. overlap 271 bp
Parental seq. overlap (%) 87.7%
Genomic Region Intergenic
Retrocopy Summary RPL39P34, located on chr10:92492497-92492796, is a retrocopy of the parental gene RPL39. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL39
Full Name ribosomal protein L39
Also known as -
Coordinate chrX:116072024-116077106
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens RPL39P39
Chimpanzee Pan troglodytes RPL39P46
Bonobo Pan paniscus RPL39P45
Gorilla Gorilla gorilla RPL39P43
Orangutan Pongo abelii RPL39P46
Gibbon Nomascus leucogenys RPL39P27
Green monkey Chlorocebus sabaeus RPL39P6
Crab-eating macaque Macaca fascicularis RPL39P34
Baboon Papio anubis RPL39P47
Golden snub-nosed monkey Rhinopithecus roxellana RPL39P38
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL39P34
GTTCCTTTCTCTGCCATCGTGGTGTGTGCTTGACTCCGCTTCTCGCCACGTCTTCTCACAAGACTTTCAGGATTAAGCAATTCCTGCCTGAGAAACAAAAGGAAAATCGTCCCATTCCCCAGTGGATTCAGATGAAAACTGGTAATAAAAACAGGTACAACTCCAAAAGGAGACACTGGAGAAAAACCAAGCTGGGTCTATAAGGAATTGCACTTGAGATGGCACACACATTTATACTGTCTGAAGGTCACAATCATGTTACCACATCAAGGTGAAAATGTCGCCACTCTCTGGAGAGTT
>NM_001267538.2
CTCTTTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGCCTCCACTTCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCCTGGCCAAGAAACAAAAGCAAAATCGTCCCATTCCCCAGTGGATTCGGATGAAAACTGGAAATAAAATAAGGTACAACTCCAAAAGGAGACACTGGAGAAGAACCAAGCTGGGTCTATAAGGAATTGCACATGAGATGGCACATATATTTGTGCTGTCTGAAGGTCACGATCACATTACCGTATCAAACTGAAAATGTCACCACTCTCTGGAGAGTTCGACG

Publications

PMID - Link Title