| Retrocopy Name | HMGN1BP20 | 
                 | 
        
| Species | Myotis myotis | |
| Coordinates | scaffold_m19_p_12:17028016-17028177 UCSC | |
| Strand | + | |
| Parental Sequence | HMGN1B_x3 | |
| Parental seq. overlap | 142 bp | |
| Parental seq. overlap (%) | 46.4% | |
| Genomic Region | 
									Intragenic (SVEP1) | 
        |
| Retrocopy Summary | HMGN1BP20, located on scaffold_m19_p_12:17028016-17028177, is a retrocopy of the parental gene HMGN1B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. | 
| Gene Name | HMGN1B | 
| Full Name | N/A | 
| Also known as | NULL | 
| Coordinate | scaffold_m19_p_2:212257150-212263650 | 
| Strand | + | 
| Gene summary | N/A | 
| Species | Scientific Name | Retrocopy | |
![]()  | 
			Pale spear-nosed bat | Phyllostomus discolor | HMGN1P5 | 
![]()  | 
			Kuhl's pipistrelle | Pipistrellus kuhlii | HMGN1CP10 | 
![]()  | 
			Human | Homo sapiens | Without Homology | 
![]()  | 
			Chimpanzee | Pan troglodytes | Without Homology | 
![]()  | 
			Bonobo | Pan paniscus | Without Homology | 
![]()  | 
			Gorilla | Gorilla gorilla | Without Homology | 
![]()  | 
			Orangutan | Pongo abelii | Without Homology | 
![]()  | 
			Gibbon | Nomascus leucogenys | Without Homology | 
![]()  | 
			Green monkey | Chlorocebus sabaeus | Without Homology | 
![]()  | 
			Crab-eating macaque | Macaca fascicularis | Without Homology | 
![]()  | 
			Rhesus | Macaca mulatta | Without Homology | 
![]()  | 
			Baboon | Papio anubis | Without Homology | 
![]()  | 
			Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology | 
![]()  | 
			Marmoset | Callithrix jacchus | Without Homology | 
![]()  | 
			Mouse lemur | Microcebus murinus | Without Homology | 
![]()  | 
			Mouse | Mus musculus | Without Homology | 
![]()  | 
			Rat | Rattus norvegicus | Without Homology | 
![]()  | 
			Chinese hamster | Cricetulus griseus | Without Homology | 
![]()  | 
			Rabbit | Oryctolagus cuniculus | Without Homology | 
![]()  | 
			Pig | Sus scrofa | Without Homology | 
![]()  | 
			Cow | Bos taurus | Without Homology | 
![]()  | 
			Sheep | Ovis aries | Without Homology | 
![]()  | 
			Dolphin | Tursiops truncatus | Without Homology | 
![]()  | 
			Horse | Equus caballus | Without Homology | 
![]()  | 
			Dog | Canis familiaris | Without Homology | 
![]()  | 
			Panda | Ailuropoda melanoleuca | Without Homology | 
![]()  | 
			Cat | Felis catus | Without Homology | 
![]()  | 
			Velvety free-tailed bat | Molossus molossus | Without Homology | 
![]()  | 
			Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology | 
![]()  | 
			Egyptian rousette | Rousettus aegyptiacus | Without Homology | 
![]()  | 
			Sloth | Choloepus didactylus | Without Homology | 
![]()  | 
			Tasmanian Devil | Sarcophilus harrisii | Without Homology | 
![]()  | 
			Opossum | Monodelphis domestica | Without Homology | 
![]()  | 
			Platypus | Ornithorhynchus anatinus | Without Homology | 
![]()  | 
			Chicken | Gallus gallus | Without Homology | 
![]()  | 
			Turkey | Meleagris gallopavo | Without Homology | 
![]()  | 
			Zebra Finch | Taeniopygia guttata | Without Homology | 
![]()  | 
			Budgerigar | Melopsittacus undulatus | Without Homology | 
![]()  | 
			Painted Turtle | Chrysemys picta | Without Homology | 
![]()  | 
			Lizard | Anolis Carolinensis | Without Homology | 
![]()  | 
			Frog | Xenopus tropicalis | Without Homology | 
![]()  | 
			Zebrafish | Danio rerio | Without Homology | 
![]()  | 
			Drosophila | Drosophila melanogaster | Without Homology | 
| >HMGN1BP20 | 
| AAGACAAAAAAGTACAAACAAAGGGAAAAGGGGAGCAAGGGGAAAGCAGGCCGAAGTGGCTAACCAGGAGCCTGAAGATCTACCTGCTGAAAACGGAGAAGCAAAAACCAAGGGAGTCCAGCCTCGGATAAAGCAGGAGAGGAAGAAGCCAAGTCTGATTAA | 
| >HMGN1B_x3 | 
| ATGCCCAAGAGGAAGGTCAGCTCTGCGGAGGGGGCGGCCAAGGAGGAGCCGAAGAGGAGGTCGGCCCGGTTGTCAGCCAAACCCGCGCCTGCGAAAGCGGAGGCGAAGCCCAAAAAGGCGGCGGGAAAGGATAAGTCTGCAGACAAGAAAGTGCAAACAAAAGGGAAGAGGGGAGCAAAGGGAAAGCAGGCGGAAGTGGCTGACCAGGAGCCTAAAGAAGACCTCCCTGCGGAAAATGGAGAAACTAAAAACGAGGAGAGTCCAACCTCAGATGAAGCAGGAGAAAAAGAAGCCAAGTCTGATTAA | 
| PMID - Link | Title | 
|---|