Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name ATP5JP2
Plot displaying the genomic locations of a retrocopy (in chr10) and its respective parental gene (in chr31). Each line represents a retrocopy.
Species Microcebus murinus
Coordinates chr10:70222254-70222439  UCSC
Strand +
Parental Sequence XM_012764447.1
Parental seq. overlap 155 bp
Parental seq. overlap (%) 26.5%
Genomic Region Intergenic
Retrocopy Summary ATP5JP2, located on chr10:70222254-70222439, is a retrocopy of the parental gene ATP5PF. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5PF
Full Name N/A
Also known as ATP5J
Coordinate chr31:27161438-27171550
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens ATP5PFP4
Chimpanzee Pan troglodytes ATP5PFP3
Bonobo Pan paniscus ATP5PFP3
Gorilla Gorilla gorilla ATP5PFP2
Orangutan Pongo abelii ATP5PFP3
Gibbon Nomascus leucogenys ATP5PFP1
Green monkey Chlorocebus sabaeus ATP5JP3
Crab-eating macaque Macaca fascicularis ATP5JP3
Rhesus Macaca mulatta ATP5PFP3
Baboon Papio anubis ATP5PFP3
Golden snub-nosed monkey Rhinopithecus roxellana ATP5PFP3
Dolphin Tursiops truncatus ATP5PFP1
Greater horseshoe bat Rhinolophus ferrumequinum ATP5PFP4
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5JP2
GGTCCATTTTCGGAGGAATGATGGTGTTACAGCAGTTGCCTTTAATAAGGAATTTGATCTTGTGCAGAAACTCTTCATGGACAAGACTAGAGAATACAATTCGAAGAGAATGGCATCTGGAGGACCTTTTGATATTGGCTCAGAATATCAGCAAGAGCTGGAGAGGAAGCATTTAAAGCATAAGCA
>XM_012764447.1
GGGAGGGTAGTTCGTCCAGCGTGGCCTCTTGGGATTCCAATTCTGGGTGTCCTCACGAGGCCTGGGCTGCCTGTCACCTCTGCTCTACTAGAAAGAGAGTAACAGAGAATCACCATGATTCTTCAGAGGCTCTTCAGGTTCTCCTCTGTCATTCGATCAGCCGTCTCAGTCCATTTGCGGAGGAACATTGGTGTTACATCAGTGGCATTTAATAAGGAACTTGATCCTGTACAGAAACTCTTCATAGACAAGATTAGAGAATACAAATCTAAACGACAGGCATCCGGAGGACCTGTTGATACTGGCCCAGAGTATCAGCAAGACCTAGAGAAGGAGCTTTTTAAGCTTAAGCAAATGCATGGTAAAGGAGATATGAATACGTTCCCTAACTTCAAATTTGACGaTCCTCAATTTGAAGTCTTCGACAAACCCCAGgcctaaagaaataaagtaaaattaatctgGTAATTTGTCATGGATTAGTTGTACAACTAATCAGAAGTTTCAGAATAAACATACATTTCACAATTGTCAAAtgttcttttaattctctttctaaataaattattgggTGATGTTGAGTGTA

Publications

PMID - Link Title