Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name FAM136AP3
Plot displaying the genomic locations of a retrocopy (in chr13) and its respective parental gene (in chr4). Each line represents a retrocopy.
Species Microcebus murinus
Coordinates chr13:42630172-42630371  UCSC
Strand +
Parental Sequence XM_012750187.2
Parental seq. overlap 165 bp
Parental seq. overlap (%) 35.4%
Genomic Region Intergenic
Retrocopy Summary FAM136AP3, located on chr13:42630172-42630371, is a retrocopy of the parental gene FAM136A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name FAM136A
Full Name N/A
Also known as -
Coordinate chr4:16282319-16292424
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Orangutan Pongo abelii ELL2P2
Gibbon Nomascus leucogenys ELL2P1
Green monkey Chlorocebus sabaeus ELL2P1
Crab-eating macaque Macaca fascicularis ELL2P2
Rhesus Macaca mulatta ELL2P2
Baboon Papio anubis ELL2P2
Golden snub-nosed monkey Rhinopithecus roxellana ELL2P2
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>FAM136AP3
GGCTGCTGTGAGAACAGCCAGACGTCCATGAAGCAGGTGCCCTAGTGCTAAGAGCGCGGCCATGCTCCTCTGGCTCAAGCTCAAGTTTTGGTGACCAAGGAGCTGGAGAAGTTCCAGGGCCGCCTGGCCGGGTGCACCTTGCATGCGTTGCAAAGACAAAGCCAAAGACTGAGTAGATACAGGAAGTAAGGAACTTCAGG
>XM_012750187.2
GCCGTTTCCCCACAGTCCAgcccgggggagggggagggccagGGGCCGGAGACAGAAGCCCTGGGGTTCGTCCCCCCAGCTTCGCCTCATGCGCGGCCCCTTCCGCAGggactCATGTTCCGGTGCAGCGCCAGCTGTTGTGAGGACAGCCAGGCTTCCATGCAGCAGGTGCACCAGTGCATTGAGCGCTGCCATGCACCTCTGGCACAAGCTCAGGCTCTGGTGACCAACGAGTTGGAGAAGTTCCAGGACCGCCTGGCCCGCTGCACCATGCATTGCAACGACAAAGCCAAAGATTCCATAGATGCAGGGAGTAAGGAGCTTCAGGTGAAGCGTCAGCTGGACGGTTGTGTGACCAAGTGTGTTGATGACCACATGCACCTCATCCCGACTATGACCAAGAAGATGAAGGAGTCTCTCGTATCCATTGGGAAATAAAAGTCTTTGCCAGTGGCCATCGGG

Publications

PMID - Link Title