Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Cldn7P1
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Mus musculus
Coordinates chr8:124887165-124887380  UCSC
Strand +
Parental Sequence NM_016887.6
Parental seq. overlap 179 bp
Parental seq. overlap (%) 13.7%
Genomic Region Intragenic (Usp32)
Retrocopy Summary Cldn7P1, located on chr8:124887165-124887380, is a retrocopy of the parental gene Cldn7. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Cldn7
Full Name claudin 7
Also known as -
Coordinate chr11:69855605-69858712
Strand +
Gene summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed constitutively in the mammary epithelium throughout development, and might be involved in vesicle trafficking to the basolateral membrane. It is essential for NaCl homeostasis in distal nephrons. The knockout mice lacking this gene showed severe salt wasting, chronic dehydration, and growth retardation, and died within 12 days after birth. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]

Homology

Species Scientific Name Retrocopy
Rat Rattus norvegicus Cldn7P1
Chinese hamster Cricetulus griseus Cldn7_1P1
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Cldn7P1
AGACTGGAGGCATCGTTTTCATGGCGGTAGGTCTTGCTGCCTTGGTAGCATGTTCCTGGGTTGGTCGTGGGATTGTCACAGACTTTTATAACCCTCTGATGCCTGTGACTGTCAAGGATGAGTTTGGTCCTGCCATCTATATCGGTTTTGCGAGGTCTTCTCTGGTCTTCCTGGGAGGTTTGCTGCTCCCTGGCTCCTGACCTGGCATTGAAAGCA
>NM_016887.6
AAGTTGCAGCGCTCCGGGTGCCTGCGGGGGCGCGTCCCCGACGTCCTGCATATATATACTCAGGTGCGCCGCACCTGCTCGCCCGCACCTGCCGCCGCACCGCCAGCTCCCTGTGCCGCGCACCGCAGCCTGGGGCCCAAGGGCCCGCATACTTTCTGGGGGCCACGCCCTAACGGCCCCTCCACTTCTTTGGGTAGTCTCGGAGCACGCCGGTAGGAACCGCCCGGCCTTCGGGGACCGCTTTTGTCTGGAACCAGTCCTTCGGGCGAAGCCGGTTCCCTCTGCTGTGAGAGTGTCGCTTCACCGGAGGGGACGATTTGTGTTTACCTCGGTTAACAAGATTTGTAGTTACCCGgtccaaaaaaaaatctttttctccTTTGGGTGACTTAAATCTCTATCCAAATTTTCTTGTGTTGCTGCTCCccggatttttgtttttttgtttttttgctttactGTAGGGTCGCCCTCCCGGCGCGTCCCGTCTTTTCTGAGACAAGGAAATGGCCAACTCGGGCCTGCAACTGCTGGGCTTTTCAATGGCCATGCTTGGCTGGGTGGGCCTGATAGCGAGCACTGCCATCCCTCAGTGGCAGATGAGCTCCTATGCGGGCGACAACATCATCACAGCCCAGGCCATGTACAAGGGGCTCTGGATGGAGTGCGTCACGCAGAGCACCGGCATGATGAGCTGCAAAATGTACGACTCGGTGCTCGCCCTGCCGGGAGCCCTGCAGGCCACTCGAGCCTTAATGGTGGTGTCCCTGGTGTTGGGCTTCTTAGCCATGTTTGTCGCCACGATGGGCATGAAGTGCACACGCTGTGGGGGAGATGACAAAGCGAAGAAGGCCCGAATAGCTATGACTGGAGGCATTGTTTTCATTGTGGCAGgtCTTGCTGCCTTGGTAGCATGTTCCTGGATTGGTCATCAGATTGTCACAGACTTTTATAACCCCTTGACGCCCATGAACGTTAAGTACGAGTTTGGACCTGCCATCTTTATCGGCTGGGCAGGGTCTGCTCTGGTCCTTCTGGGAGGTGccctgctctcttgctcctgtccAGGCAGTGAAAGCAAAGCTGCGTACCGAGCACCCCGCTCTTACCCCAAGTCCAATTCCTCCAAGGAATACGTGTGAGCTGGGGAGCCCAGCCTGCGGGCAGGGTGGGAGGCAAAGGCCTCCTGGCCACTCcacctccaaacatcatgtataGTTTGCTTGGGGGGAGGGCAGTTGGGGGGTTACTGGGAGAGGAAGACATGGGGTGTGCTTTTgtacagaaataaaattaagttttggAAATTAG

Publications

PMID - Link Title