| Retrocopy Name | Cldn7P1 |
|
| Species | Mus musculus | |
| Coordinates | chr8:124887165-124887380 UCSC | |
| Strand | + | |
| Parental Sequence | NM_016887.6 | |
| Parental seq. overlap | 179 bp | |
| Parental seq. overlap (%) | 13.7% | |
| Genomic Region |
Intragenic (Usp32) |
|
| Retrocopy Summary | Cldn7P1, located on chr8:124887165-124887380, is a retrocopy of the parental gene Cldn7. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | Cldn7 |
| Full Name | claudin 7 |
| Also known as | - |
| Coordinate | chr11:69855605-69858712 |
| Strand | + |
| Gene summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed constitutively in the mammary epithelium throughout development, and might be involved in vesicle trafficking to the basolateral membrane. It is essential for NaCl homeostasis in distal nephrons. The knockout mice lacking this gene showed severe salt wasting, chronic dehydration, and growth retardation, and died within 12 days after birth. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010] |
| Species | Scientific Name | Retrocopy | |
![]() |
Rat | Rattus norvegicus | Cldn7P1 |
![]() |
Chinese hamster | Cricetulus griseus | Cldn7_1P1 |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >Cldn7P1 |
| AGACTGGAGGCATCGTTTTCATGGCGGTAGGTCTTGCTGCCTTGGTAGCATGTTCCTGGGTTGGTCGTGGGATTGTCACAGACTTTTATAACCCTCTGATGCCTGTGACTGTCAAGGATGAGTTTGGTCCTGCCATCTATATCGGTTTTGCGAGGTCTTCTCTGGTCTTCCTGGGAGGTTTGCTGCTCCCTGGCTCCTGACCTGGCATTGAAAGCA |
| >NM_016887.6 |
| AAGTTGCAGCGCTCCGGGTGCCTGCGGGGGCGCGTCCCCGACGTCCTGCATATATATACTCAGGTGCGCCGCACCTGCTCGCCCGCACCTGCCGCCGCACCGCCAGCTCCCTGTGCCGCGCACCGCAGCCTGGGGCCCAAGGGCCCGCATACTTTCTGGGGGCCACGCCCTAACGGCCCCTCCACTTCTTTGGGTAGTCTCGGAGCACGCCGGTAGGAACCGCCCGGCCTTCGGGGACCGCTTTTGTCTGGAACCAGTCCTTCGGGCGAAGCCGGTTCCCTCTGCTGTGAGAGTGTCGCTTCACCGGAGGGGACGATTTGTGTTTACCTCGGTTAACAAGATTTGTAGTTACCCGgtccaaaaaaaaatctttttctccTTTGGGTGACTTAAATCTCTATCCAAATTTTCTTGTGTTGCTGCTCCccggatttttgtttttttgtttttttgctttactGTAGGGTCGCCCTCCCGGCGCGTCCCGTCTTTTCTGAGACAAGGAAATGGCCAACTCGGGCCTGCAACTGCTGGGCTTTTCAATGGCCATGCTTGGCTGGGTGGGCCTGATAGCGAGCACTGCCATCCCTCAGTGGCAGATGAGCTCCTATGCGGGCGACAACATCATCACAGCCCAGGCCATGTACAAGGGGCTCTGGATGGAGTGCGTCACGCAGAGCACCGGCATGATGAGCTGCAAAATGTACGACTCGGTGCTCGCCCTGCCGGGAGCCCTGCAGGCCACTCGAGCCTTAATGGTGGTGTCCCTGGTGTTGGGCTTCTTAGCCATGTTTGTCGCCACGATGGGCATGAAGTGCACACGCTGTGGGGGAGATGACAAAGCGAAGAAGGCCCGAATAGCTATGACTGGAGGCATTGTTTTCATTGTGGCAGgtCTTGCTGCCTTGGTAGCATGTTCCTGGATTGGTCATCAGATTGTCACAGACTTTTATAACCCCTTGACGCCCATGAACGTTAAGTACGAGTTTGGACCTGCCATCTTTATCGGCTGGGCAGGGTCTGCTCTGGTCCTTCTGGGAGGTGccctgctctcttgctcctgtccAGGCAGTGAAAGCAAAGCTGCGTACCGAGCACCCCGCTCTTACCCCAAGTCCAATTCCTCCAAGGAATACGTGTGAGCTGGGGAGCCCAGCCTGCGGGCAGGGTGGGAGGCAAAGGCCTCCTGGCCACTCcacctccaaacatcatgtataGTTTGCTTGGGGGGAGGGCAGTTGGGGGGTTACTGGGAGAGGAAGACATGGGGTGTGCTTTTgtacagaaataaaattaagttttggAAATTAG |
| PMID - Link | Title |
|---|