Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Atp5eP1
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Mus musculus
Coordinates chr8:96449132-96449270  UCSC
Strand +
Parental Sequence NM_025983.3
Parental seq. overlap 121 bp
Parental seq. overlap (%) 29.2%
Genomic Region Intragenic (Cnot1)
Retrocopy Summary Atp5eP1, located on chr8:96449132-96449270, is a retrocopy of the parental gene Atp5e. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Atp5e
Full Name ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Also known as 2410043G19Rik|ATPE|Atp5f1e
Coordinate chr2:174302868-174305894
Strand -
Gene summary Predicted to enable P-type proton-exporting transporter activity. Predicted to contribute to ATP hydrolysis activity and proton-transporting ATP synthase activity, rotational mechanism. Predicted to be involved in mitochondrial ATP synthesis coupled proton transport. Predicted to act upstream of or within ATP synthesis coupled proton transport. Located in mitochondrial inner membrane. Human ortholog(s) of this gene implicated in mitochondrial complex V (ATP synthase) deficiency nuclear type 3. Orthologous to several human genes including ATP5F1E (ATP synthase F1 subunit epsilon). [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Atp5eP1
TCATGGTGGCATACTAGCAACAGACTGGATTCAGCTACATCTGGTAGTCCTAGATCAGTGCCAAAGCAGCGAGGGATGCCCTGAAGACCAAGTTCAAAGCAAACGCTAAGACTTCTGGCAGGAGCATAAAAACTGTGAA
>NM_025983.3
CCCACCCCTTCCGCTACTCAGGCCTGACCTTCCTGCTGCCGGGCCGGTTTGAGGCTACTCTGAAGCGACCCAGCGGTTCTGCCCGACGCGCCCGCTCGAGACACCATGGTGGCGTACTGGCGACAGGCTGGACTCAGCTACATCCGGTTTTCCCAGATCTGTGCAAAAGCAGTGAGGGATGCCCTGAAGACCGAGTTCAAAGCGAACGCTGAGAAGACTTCGGGCAGCAGCATAAAAATTGTGAAAGTCTCGAAGAAGGAGTAGCTGaatCTGAAGCCTGAAGTGCTGAGTCTTGAAGGTGAAGCATGTGGGCCCCTGTTCTGGCAGATGGAAATCAACCTCACCTCCTGGGGGACAGGCTGCCCATCTCGTTGATAAATTGACTATGCCAATAAATTAACATGGTTCACTTTC

Publications

PMID - Link Title