| Retrocopy Name | Ndufa2P2 |
|
| Species | Mus musculus | |
| Coordinates | chr9:64946230-64946372 UCSC | |
| Strand | - | |
| Parental Sequence | NM_010885.5 | |
| Parental seq. overlap | 123 bp | |
| Parental seq. overlap (%) | 20.4% | |
| Genomic Region |
Intragenic (Cacnb2) Intragenic (Dpp8) |
|
| Retrocopy Summary | Ndufa2P2, located on chr9:64946230-64946372, is a retrocopy of the parental gene Ndufa2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | Ndufa2 |
| Full Name | NADH:ubiquinone oxidoreductase subunit A2 |
| Also known as | B8|C1-B8|CI-B8 |
| Coordinate | chr18:36875385-36877640 |
| Strand | - |
| Gene summary | This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. The human ortholog of this gene has been characterized, and its structure and redox potential is reported to be similar to that of thioredoxins. It may be involved in regulating complex I activity or assembly via assistance in redox processes. In humans, mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. A pseudogene of this gene is located on chromosome 5. [provided by RefSeq, May 2013] |
| Species | Scientific Name | Retrocopy | |
![]() |
Rat | Rattus norvegicus | Ndufa2P4 |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >Ndufa2P2 |
| GTGCTGCCCAAACTCTGGGCCCTCTATGCTTTTGGCCAAGAGAAGACTGTGTGTCTCTGAATAACCTGAGTGCTGCTGATGTAACCAGAGCCCTGGAGAAGGTGCTGCGTGGCAAAGCCTGGGGTCTCCACCGAGGACTGTGC |
| >NM_010885.5 |
| TGGAGGGCCCGCTATTGGTCCGATTGAGGGTGAAAGGTCGTGATTGGGCGCTCCTTTGCTAACAAAGATGGCGGCTGCCGCTGCTAGCCGAGCGGTCGGCGCAAAGCTGGGGTTGCGTGAGATTCGCGTTCACTTATGCCAGCGTTCCCCAGGCAGCCAGGGTGTGAGggaTTTCATCGTGCAACGGTACGTGGAGCTGAAGAAGGCGCACCCCAACCTGCCCATTCTGATCCGCGAATGCTCGGAGGTGCAGCCCAAGCTTTGGGCCCGCTATGCTTTTGGCCAAGAGAAGACGGTGTCTCTGAACAATCTGAGTGCTGATGAGGTAACCAGAGCCATGCAGAATGTGCTAAGCGGCAAAGCCTGAAGGTCTCCACTGAGGACTGTGAGCGAGAGCAGCTGAACCTGCTGGACTGAAGACAGTGTGGGGAAATGTGTGCTTTGGGTCCTTATAAAGCTTACGCTGTACAGTGTCCCTTCAGAATGTCCTCTTCATTACCTTCTCCCTCTTACTGCGCAACACTGAGGCAAAGtagttttatataaaaatactcCTTTAtttctcctcaaaaaaaaaaaaaaaaaaaacccaccaggtGCCA |
| PMID - Link | Title |
|---|