Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Ndufa2P2
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr18). Each line represents a retrocopy.
Species Mus musculus
Coordinates chr9:64946230-64946372  UCSC
Strand -
Parental Sequence NM_010885.5
Parental seq. overlap 123 bp
Parental seq. overlap (%) 20.4%
Genomic Region Intragenic (Cacnb2)
Intragenic (Dpp8)
Retrocopy Summary Ndufa2P2, located on chr9:64946230-64946372, is a retrocopy of the parental gene Ndufa2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Ndufa2
Full Name NADH:ubiquinone oxidoreductase subunit A2
Also known as B8|C1-B8|CI-B8
Coordinate chr18:36875385-36877640
Strand -
Gene summary This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. The human ortholog of this gene has been characterized, and its structure and redox potential is reported to be similar to that of thioredoxins. It may be involved in regulating complex I activity or assembly via assistance in redox processes. In humans, mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. A pseudogene of this gene is located on chromosome 5. [provided by RefSeq, May 2013]

Homology

Species Scientific Name Retrocopy
Rat Rattus norvegicus Ndufa2P4
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Ndufa2P2
GTGCTGCCCAAACTCTGGGCCCTCTATGCTTTTGGCCAAGAGAAGACTGTGTGTCTCTGAATAACCTGAGTGCTGCTGATGTAACCAGAGCCCTGGAGAAGGTGCTGCGTGGCAAAGCCTGGGGTCTCCACCGAGGACTGTGC
>NM_010885.5
TGGAGGGCCCGCTATTGGTCCGATTGAGGGTGAAAGGTCGTGATTGGGCGCTCCTTTGCTAACAAAGATGGCGGCTGCCGCTGCTAGCCGAGCGGTCGGCGCAAAGCTGGGGTTGCGTGAGATTCGCGTTCACTTATGCCAGCGTTCCCCAGGCAGCCAGGGTGTGAGggaTTTCATCGTGCAACGGTACGTGGAGCTGAAGAAGGCGCACCCCAACCTGCCCATTCTGATCCGCGAATGCTCGGAGGTGCAGCCCAAGCTTTGGGCCCGCTATGCTTTTGGCCAAGAGAAGACGGTGTCTCTGAACAATCTGAGTGCTGATGAGGTAACCAGAGCCATGCAGAATGTGCTAAGCGGCAAAGCCTGAAGGTCTCCACTGAGGACTGTGAGCGAGAGCAGCTGAACCTGCTGGACTGAAGACAGTGTGGGGAAATGTGTGCTTTGGGTCCTTATAAAGCTTACGCTGTACAGTGTCCCTTCAGAATGTCCTCTTCATTACCTTCTCCCTCTTACTGCGCAACACTGAGGCAAAGtagttttatataaaaatactcCTTTAtttctcctcaaaaaaaaaaaaaaaaaaaacccaccaggtGCCA

Publications

PMID - Link Title