Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Nop10P2
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Mus musculus
Coordinates chr8:40128970-40129297  UCSC
Strand -
Parental Sequence NM_025403.4
Parental seq. overlap 198 bp
Parental seq. overlap (%) 26.8%
Genomic Region Intergenic
Retrocopy Summary Nop10P2, located on chr8:40128970-40129297, is a retrocopy of the parental gene Nop10. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Nop10
Full Name NOP10 ribonucleoprotein
Also known as 1110036B12Rik|NOP10P|Nola3
Coordinate chr2:112092271-112093243
Strand +
Gene summary Predicted to enable box H/ACA snoRNA binding activity and telomerase RNA binding activity. Predicted to be involved in snRNA pseudouridine synthesis; snoRNA guided rRNA pseudouridine synthesis; and telomere maintenance via telomerase. Predicted to act upstream of or within rRNA processing. Predicted to be located in nuclear body. Predicted to be part of box H/ACA snoRNP complex and box H/ACA telomerase RNP complex. Is expressed in several structures, including alimentary system; brain; cardiovascular system; genitourinary system; and integumental system. Human ortholog(s) of this gene implicated in autosomal recessive dyskeratosis congenita 1. Orthologous to human NOP10 (NOP10 ribonucleoprotein). [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Nop10P2
TGTTTCTCCAGTATTACCTCAAGGAGTAAGGCGATCAGGTCTATATCCTGAAGTAAATTGACTCTATGGGACAACAAACTTGCTCTGCCCATCCTGATCTCCCAGATGACAAATACTTAAGACACAGAATCACCATCAAGAAATGCTTCAAGGTACTCATGACCCAGCAACTGAATCTTGTCCTCTGAAGGCTCATTAATCTTTTGTGCTTCTTCTATACTGATGGGCT
>NM_025403.4
GTCCAATCTGGAAGGTTGTTGGCGCACGCGATTGAAGCGGCGCACTCGGAGTAAACGCGGCTGGCGGTAGTACGTGTGTCTTTTTGCTGAGGGCAGTTATGTTTCTCCAATATTACCTCAACGAGCAGGGCGATCGCGTTTATACGCTGAAGAAATTTGACCCTATGGGACAACAGACTTGCTCCGCCCATCCTGCTCGGTTCTCCCCAGATGACAAATATTCAAGACACCGAATCACCATCAAGAAACGCTTCAAGGTGCTCATGACCCAGCAACCGCGTCCTGTCCTCTGAGGGCTCGTTAATCTTTTACGCTGCTCATGCCTCGGCCTATTATCAGCAACCAAACGCGTCAATCTGTAAGCCTTGAAGCCTTCCCATGCTGTTTGGAATCCTATCTCACTCACCACGTGAATGAGTCTATACTGATGGGCCTCGCCTGTAAAAGgaacaatatttttctttctttttttcatgccAGGTTATTAAAGATATAGTGAACTGAAAGTTCATTTTGTGTGTTgttggaggaagagatgggggaagggtagTACCGTTGGTAGTACAAGGCCACTTGAGAACATTCGTAAGCCCTCATTGTAGCAATAGAACTGTGTGCCATCGACGATAGGGTGTTGGGGGGAAAAAGGCTGTGAAAGACTCCTACAAAGGTCAGCATTCCCTGGAAAACTACTGTCTAATTGTGggccctttaaaaaatattctgaattcctcaaag

Publications

PMID - Link Title