Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name ATP5MDP1
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr26). Each line represents a retrocopy.
Species Bos taurus
Coordinates chr1:96744788-96744937  UCSC
Strand +
Parental Sequence NM_001113318.1
Parental seq. overlap 127 bp
Parental seq. overlap (%) 35.9%
Genomic Region Intergenic
Retrocopy Summary ATP5MDP1, located on chr1:96744788-96744937, is a retrocopy of the parental gene ATP5MK. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5MK
Full Name ATP synthase membrane subunit k
Also known as AGP|ATP5MD|DAPIT|USMG5
Coordinate chr26:23982412-23987702
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Sheep Ovis aries ATP5MDP1
Dolphin Tursiops truncatus ATP5MDP1
Horse Equus caballus ATP5MDP2
Dog Canis familiaris ATP5MKP10
Panda Ailuropoda melanoleuca ATP5MDP2
Cat Felis catus ATP5MDP7
Pale spear-nosed bat Phyllostomus discolor ATP5MDP2
Egyptian rousette Rousettus aegyptiacus ATP5MDP1
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5MDP1
TCCCAATTCCATTTCACTGATGTTAAAAAATATTTCAACTCATACTCTCACAGGTAGAATGAATTGTGTACTGGCCATGTGTGGAGGTTTTGCTTTGATGGTTTTACGCTTCAAGCTATCATCTAACACTCCAGCTGTGAAAGCAACATA
>NM_001113318.1
GATCGAGGGGCAGCAGCGTACGGTGAAGGACACAGGCCGTGGAGTTTGAACCCCTTGAAAGATTGAAATCATGGCAGGTCCAGAAGCTGATGCCCAGTTCCATTTCACTGGTATCAAAAAATATTTCAACTCTTACACTCTCACAGGGAGAATGAATTGTGTGCTGGCCACATACGGAAGTATTGCTTTGATAGTCTTATACTTCAAGTTAAGGTCTAAAAAAACTCCAGCTGTGAAAGCAACATAAACAGATTCTGAGCTGTACATTATCTGTTAAGTTCCCATGCCTGAAGAAGCTAATGTCAACTCATCATGTGATACTCAATTTGTACAATAAATTATGAACCTGGAAAA

Publications

PMID - Link Title