Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name SELENOWP1
Plot displaying the genomic locations of a retrocopy (in chr7) and its respective parental gene (in chr18). Each line represents a retrocopy.
Species Bos taurus
Coordinates chr7:30831920-30832292  UCSC
Strand +
Parental Sequence NM_001163225.1
Parental seq. overlap 325 bp
Parental seq. overlap (%) 33.7%
Genomic Region Intragenic (SNX24)
Retrocopy Summary SELENOWP1, located on chr7:30831920-30832292, is a retrocopy of the parental gene SELENOW. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name SELENOW
Full Name selenoprotein W
Also known as SEPW1
Coordinate chr18:54671617-54675883
Strand +
Gene summary This gene encodes a selenoprotein containing a selenocysteine (Sec) residue, which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is highly expressed in skeletal muscle and brain. It belongs to the SelWTH family, which possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif, suggesting a redox function for this gene. Studies in mouse show that this selenoprotein is involved in muscle growth and differentiation, and in the protection of neurons from oxidative stress during neuronal development. Pseudogenes of this locus have been identified on chromosomes 7 and 19. [provided by RefSeq, Aug 2017]

Homology

Species Scientific Name Retrocopy
Sheep Ovis aries SELENOWP1
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>SELENOWP1
TCAAGTATCTTCAGCTCAAAAAGAAGTTAGAAGATGGGTTCCCTGGATGCTTGGACATTTGCAGCAAGGGGACTCACCAGGTCACTGGCTTCTTTGAAGTGTTCGTAGCAGGGAAGCCGGTTCATTCCAAGAAGGGAGGTGATGGCTACATGGACATGGAGAGCAAGTTTCTGAAGCTGGTGGCCGCCATCAAAGCTGCTCTGGCTCAGGCCGCATGTGCCCTGAAGGCAGAGGCCAGTGACCTTGGCTCAGCCCCTCTTGGCCGATGCTTCATGATAGGAAGGACTGAAATGTCTTGTGGACACCTGGCCCTTCCCTAATGTTCTCAGGCTGCTGACTGGGGACAGAGGGACACCCCTGGTCCTTGCCTGTG
>NM_001163225.1
GCGAGGTGCGCAGAGGGCTCTCCTGAGGACCCCCTCTGCTGGGGTTTTCCCTGGCCTCACAGCGGGCGAGGGGGAAGATTTGCGTGGCGGGCTCAGGGCGGTGGGCGGCAGGGTTCCTCTCGCCCCCGCTCTGGGGGCCTCTCCTCATCCCCCCCTCTCCCGGCGTTGGTCCGCGCTGCGGAACGCCGAGTGTCAGGCCTGTGTGCGCACGCCCCGCCCGTGGCGCAGACCTCGCCTTGCCTCGCCCGGGTTCGGATCGCGAGTCCGCGCCGCAGCGGGCACCGCGGTCCGGAGCTATGGCGGTCGTCGTCCGAGTAGTTTATTGTGGCGCTTGAGGCTACAAGCCCAAGTATCTTCAGCTCAAGAAGAAGTTAGAAGATGAGTTCCCTAGCCGTCTGGACATCTGCGGCGAGGGGACTCCCCAGGTCACCGGCTTCTTTGAAGTGTTCGTAGCGGGAAAGCTGGTTCACTCCAAGAAGGGAGGCGATGGCTACGTGGACACGGAGAGCAAGTTTCTGAAGCTGGTGGCCGCCATCAAAGCCGCTTTGGCTCAGGCCTGATGTGGCCTAAAGGCAGAGACCAGTAATCGTGGCCCAGCCCCTCTCGGCAGACGCTTCATGACAGGAAGGACTGAAATGTCTCTTGGACGCCTGGTCCTTCCCTGATGTTCTCGCGGCCGCCGGTTGGAGCAGAGATGGACACCCCTGGTCTTTGCCtgtgcgtgcgtgtgtgcgtgtgtgtCCCCGCACGCTGGTCCTGGTGCCTTCCCCATCCCTCATCTCCCTGCATCTCCACCGCCCCTCCCCCCATGTCTCCCTTCTATCCTGTGGTGTCTGGGGTGGTCCTACTCTAGGCTTCCTTTTCAAGGGGAAGCTGAGAGGATGATCAGGATGAGTGAGTCTCAGATATCAGCAGTGATGGCAACAGCTCACAACGCAATAAATGGTGATGAGGTTAACAAAA

Publications

PMID - Link Title